Gene

EGFR

epidermal growth factor receptor

Explore in graph →CI-GENE-00044375HGNC:3236 ENSG00000146648 NCBI 1956 CIViC Cancer geneApproved

Curated evidence

Clinical evidence (644)

CIViC items involving this gene, grouped by molecular profile and therapy, with native levels and directions. 50 items per page.

civicCuratedShowing 551–600 of 644 evidence items · levels, directions and significance as curated at the source; each row links to its CIViC record.

Therapy	Cancer	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
EGFR T790M43
(oncogenic)	Lung Non-Small Cell CarcinomaCURATED_BROADER	Oncogenic	D	Supports Oncogenicity	3	submitted

Cohorts

Alteration frequency by cohort (195)

Frequency = cases affected / cases profiled within one cohort. Cohorts are never pooled.

cbioportalObserved195 cohort rows (showing 50, sorted by frequency) · frequency = affected / profiled, as published by each cohort; cohorts are not pooled. Hover a row badge for its release.

Cohort	Mapped cancer	Alteration	Affected (n)	Profiled (n)	Frequency (%)	Rank in cohort	Source
BRAF Fusions - IMPACT Clinical Sequencing Cohort (MSK, Clin Cancer Res 2024) braf_msk_impact_2024	unmapped	Ssm	10

Literature

Linked publications (141)

25 per page, newest first.

pubmedPublishedShowing 1–25 of 141 publications · bibliographic data as recorded by PubMed; abstracts are not reproduced.

EGFR T790M resistance mutation in non small-cell lung carcinoma.
· Clin Chim Acta · 2015 · PMID 25668228 · validated civic_curation pubmed
Osimertinib: First Global Approval.
· Drugs · 2016 · PMID 26729184 · validated civic_curation pubmed
Osimertinib or Platinum-Pemetrexed in EGFR T790M-Positive Lung Cancer.
· N Engl J Med · 2017 · PMID 27959700 · validated civic_curation pubmed
U.S. Food and Drug Administration approval summary: Erlotinib for the first-line treatment of metastatic non-small cell lung cancer with epidermal growth factor receptor exon 19 deletions or exon 21 (L858R) substitution mutations.
· Oncologist · 2014 · PMID 24868098 · validated civic_curation

EGFR Exon 19 del + EGFR T790M1
Osimertinib	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	accepted	EID12946 A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic

EGFR Exon 19 del + EGFR T790M1

Osimertinib

Lung Adenocarcinoma

Predictive

Supports Sensitivity Response

accepted

EID12946

A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC)

PMID 38074875 · Xiang et al., 2023 · Open in CIViC

civic

EGFR Exon 19 Deletion + EGFR T790M2
Osimertinib	Lung Non-Small Cell CarcinomaCURATED_BROADER	Predictive	A	Supports Sensitivity Response	4	accepted	EID11598 This phase 3 trial (NCT02151981) involved 419 patients with EGFR T790M mutant NSCLC who progressed after first-line EGFR inhibitor therapy (gefitinib, erlotinib, or afatinib) and were either treated w… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC	civic
〃	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	1	accepted	EID1397 Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC	civic

EGFR Exon 19 Deletion + EGFR T790M2

Osimertinib

Lung Non-Small Cell CarcinomaCURATED_BROADER

Predictive

Supports Sensitivity Response

accepted

EID11598

This phase 3 trial (NCT02151981) involved 419 patients with EGFR T790M mutant NSCLC who progressed after first-line EGFR inhibitor therapy (gefitinib, erlotinib, or afatinib) and were either treated w… (full text at CIViC)

PMID 27959700 · Mok et al., 2017 · Open in CIViC

civic

〃

Lung Adenocarcinoma

Predictive

Supports Sensitivity Response

accepted

EID1397

Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC)

PMID 26181354 · Yu et al., 2015 · Open in CIViC

civic

EGFR C797S + EGFR Exon 19 Deletion + EGFR T790M2
CH7233163	Malignant Lung Neoplasm	Predictive	D	Supports Sensitivity Response	3	submitted	EID13252 The novel tyrosine kinase inhibitor (TKI) CH7233163 has been reported to effectively overcome osimertinib resistance mediated by the EGFR Del19/T790M/C797S triple mutation. In vitro evaluation using e… (full text at CIViC) PMID 32943545 · Kashima et al., 2020 · Open in CIViC	civic
Osimertinib	Lung Adenocarcinoma	Predictive	C	Supports Resistance	1	accepted	EID1396 Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC	civic

EGFR C797S + EGFR Exon 19 Deletion + EGFR T790M2

CH7233163

Malignant Lung Neoplasm

Predictive

Supports Sensitivity Response

submitted

EID13252

The novel tyrosine kinase inhibitor (TKI) CH7233163 has been reported to effectively overcome osimertinib resistance mediated by the EGFR Del19/T790M/C797S triple mutation. In vitro evaluation using e… (full text at CIViC)

PMID 32943545 · Kashima et al., 2020 · Open in CIViC

civic

Osimertinib

Lung Adenocarcinoma

Predictive

Supports Resistance

accepted

EID1396

PMID 26181354 · Yu et al., 2015 · Open in CIViC

civic

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1
Capmatinib + OsimertinibCombination	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	submitted	EID11693 A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1

Capmatinib + OsimertinibCombination

Lung Adenocarcinoma

Predictive

Supports Sensitivity Response

submitted

EID11693

A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC)

PMID 38074875 · Xiang et al., 2023 · Open in CIViC

civic

EGFR T790M + EGFR Fusion1

Icotinib

Lung Adenocarcinoma

Predictive

Supports Resistance

accepted

EID10895

A patient was initially diagnosed with stage IIIA lung adenocarcinoma with EGFR L858R and was treated with lobectomy and adjuvant pemetrexed and cisplatin. 20 months later the patient had recurrent di… (full text at CIViC)

PMID 35004270 · Wang et al., 2021 · Open in CIViC

civic