Variant · Snv

EGFR T790M

CI-VAR-00004341Explore in graph →NP_005219.2:p.Thr790MetNM_005228.4:c.2369C>TClinVar 16613 CIViC 34 rs121434569

Curated evidence

Evidence by cancer (61 items)

Grouped by cancer context first, then therapy. The same variant can be sensitizing in one cancer and irrelevant in another — contexts are never merged. 50 items per page; a cancer group may continue on the next page.

civicCuratedShowing 1–50 of 61 evidence items across 4 cancer contexts on this page · levels, directions and significance as curated at the source; each row links to its CIViC record.

Molecular profile	Therapy	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
Cholangiocarcinoma1
EGFR T790M	(prognostic)	Prognostic	B	Supports Better Outcome	1	submitted	EID10358 In a Thai cohort of 81 patients with cholangiocarcinoma, 17 patients harbored EGFR variants, 9 of which were T790M. EGFR T790M variants were associated with longer overall survival than patients with … (full text at CIViC) PMID 29066915 · Trachu et al., 2017 · Open in CIViC	civic
Chronic Myeloid Leukemia, BCR-ABL1 Positive1
EGFR T790M	Bosutinib	Predictive	D	Does Not Support Resistance	2	submitted	EID3812 In an in vitro kinase study, the recombinant ABL1 M351T mutant kinase did not demonstrate resistance to bosutinib treatment at concentrations of 1μM and 10μM (activity %: 2 and 0) when compared to wil… (full text at CIViC) PMID ·

ClinVar

Clinical significance (1)

ClinVar interpretations are shown as structured records — significance, review status, star rating, conditions — never flattened into one word.

clinvarCurated1 interpretation · review status and star rating as assigned by ClinVar.

Variation	Clinical significance	Review status	Stars	Conditions	Origin	Submitters	Last evaluated	Source
16613	drug response	reviewed by expert panel	3	Tyrosine kinase inhibitor response; Non-small cell lung carcinoma; erlotinib response - Efficacy; EGFR-related lung cancer; Hereditary cancer-predisposing syndrome; gefitinib response - Efficacy; Lung cancer; Inflammatory skin and bowel disease, neonatal, 2; Lung adenocarcinoma; Neoplasm; EGFR-related disorder	germline/somatic	14

Lung Adenocarcinoma13
BRAF V600E AND EGFR L858R AND EGFR T790M	Osimertinib	Predictive	C	Supports Resistance	3	submitted	EID11098 A 42 year old man with non-smoking history presented with EGFR L858R positive lung adenocarcinoma. He was given various treatments including erlotinib and gefitinib and progressed four years later. bi… (full text at CIViC) PMID 29074209 · Bearz et al., 2017 · Open in CIViC	civic
EGFR L858R AND EGFR T790M AND MET Exon 14 Skipping Mutation	Tepotinib	Predictive	C	Supports Sensitivity Response	3	submitted	EID11486 A 76-year old woman (non-smoker) presented with stage IVB ling adenocarcinoma. Genetic testing was positive for EGFR L858R and T790M and osimertinib was given. Partial response was noted until progres… (full text at CIViC) PMID 36313664 · Takamori et al., 2022 · Open in CIViC	civic
EGFR L858R AND EGFR T790M AND VOPP1::EGFR Fusion	Osimertinib	Predictive	C	Supports Sensitivity Response	3	submitted	EID12549 A 67 year old female with stage IIIA lung adenocarcinoma had right lobectomy followed by 4 cycles adjuvant chemotherapy with pemetrexed and cisplatin. Next generation sequencing (NGS) found EGFR L858R… (full text at CIViC) PMID 35004270 · Wang et al., 2021 · Open in CIViC	civic
EGFR T790M	(oncogenic)	Oncogenic	D	Supports Oncogenicity	3	accepted	EID12925 In this study, the authors investigated the role of the EGFR T790M mutation using inducible mouse lung tumor models expressing T790M alone or in combination with the activating L858R mutation. They de… (full text at CIViC) PMID 17726540 · Regales et al., 2007 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	C	Supports Resistance	—	submitted	EID3806 In a lung adenocarcinoma patient with EGFR E746_A751>A (a known erlotinib sensitizing mutation) and EGFR T790M co-mutation treated with erlotinib monotherapy, EGFR T790M was associated with disease pr… (full text at CIViC) PMID 17085664 · Balak et al., 2006 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	C	Supports Resistance	3	submitted	EID12945 A 53-year-old Chinese man and lifelong non-smoker presented with chest tightness and pain. CT scans revealed multiple small lung nodules in the right lower lobe were seen with CT scan. Biopsy confirme… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic
EGFR T790M	Erlotinib + GefitinibSubstitutes	Predictive	B	Supports Resistance	3	accepted	EID1391 155 patients with lung adenocarcinomas underwent rebiopsy and genotyping (EGFR, AKT1, BRAF, ERBB2, KRAS, MEK1, NRAS, PIK3CA and FISH for MET and HER2) after the development of acquired resistance to E… (full text at CIViC) PMID 23470965 · Yu et al., 2013 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	C	Supports Sensitivity Response	2	accepted	EID2157 In a lung adenocarcinoma patient harboring an EGFR E746_A750 mutation and an acquired EGFR T790M co-mutation, EGFR T790M was associated with sensitivity to osimertinib monotherapy. Prior to the develo… (full text at CIViC) PMID 26269204 · Planchard et al., 2015 · Open in CIViC	civic
EGFR T790M AND EGFR Exon 19 del	Osimertinib	Predictive	C	Supports Sensitivity Response	3	accepted	EID12946 A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic
EGFR T790M AND EGFR Exon 19 Deletion	Osimertinib	Predictive	C	Supports Sensitivity Response	1	accepted	EID1397 Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC	civic
EGFR T790M AND EGFR Exon 19 Deletion AND EGFR C797S	Osimertinib	Predictive	C	Supports Resistance	1	accepted	EID1396 Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC	civic
EGFR T790M AND EGFR Exon 19 Deletion AND MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTC	Capmatinib + OsimertinibCombination	Predictive	C	Supports Sensitivity Response	3	submitted	EID11693 A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic
EGFR T790M AND VOPP1::EGFR Fusion	Icotinib	Predictive	C	Supports Resistance	2	accepted	EID10895 A patient was initially diagnosed with stage IIIA lung adenocarcinoma with EGFR L858R and was treated with lobectomy and adjuvant pemetrexed and cisplatin. 20 months later the patient had recurrent di… (full text at CIViC) PMID 35004270 · Wang et al., 2021 · Open in CIViC	civic

Lung Adenocarcinoma13

BRAF V600E AND EGFR L858R AND EGFR T790M

Osimertinib

Predictive

Supports Resistance

submitted

EID11098

A 42 year old man with non-smoking history presented with EGFR L858R positive lung adenocarcinoma. He was given various treatments including erlotinib and gefitinib and progressed four years later. bi… (full text at CIViC)

PMID 29074209 · Bearz et al., 2017 · Open in CIViC

Lung Non-Small Cell Carcinoma35
EGFR L858R AND EGFR T790M	Osimertinib	Predictive	A	Supports Sensitivity Response	4	accepted	EID11599 This phase 3 trial (NCT02151981) involved 419 patients with EGFR T790M mutant NSCLC who progressed after first-line EGFR inhibitor therapy (gefitinib, erlotinib, or afatinib) and were either treated w… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC	civic
EGFR L858R OR EGFR T790M	Deguelin	Predictive	D	Supports Sensitivity Response	3	submitted	EID12206 Deguelin exhibits a potent inhibitory effect in gefitinib-resistant H1975 cells with EGFR L858R/T790M mutation. Decreased phosphorylation was noted in cell lines treated with deguelin but not gefitini… (full text at CIViC) PMID 32081857 · Gao et al., 2020 · Open in CIViC	civic
EGFR T790M	(prognostic)	Prognostic	B	Supports Poor Outcome	4	accepted	EID369 In NSCLC patients with T790M and another activating mutations, their progression free survival is shorter compared to those who do not possess T790M mutation. PMID 24623981 · Ding et al., 2014 · Open in CIViC	civic
EGFR T790M	(prognostic)	Prognostic	B	Supports Poor Outcome	4	accepted	EID370 Patients with NSCLC harboring EGFR T790M mutation have statistically worse overall survival compared to patients with L858R or other exon 19 activating mutations. PMID 24729716 · Li et al., 2014 · Open in CIViC	civic
EGFR T790M	(oncogenic)	Oncogenic	D	Supports Oncogenicity	3	submitted	EID12922 In this study, the authors evaluated the functional effects of the EGFR T790M variant in non-small cell lung cancer (NSCLC) by expressing wild-type and mutant EGFR in HEK293T, COS-7, and human bronchi… (full text at CIViC) PMID 17510392 · Vikis et al., 2007 · Open in CIViC	civic
EGFR T790M	(oncogenic)	Oncogenic	D	Supports Oncogenicity	3	submitted	EID12923 In this study, the authors evaluated the catalytic activity of epidermal growth factor receptor (EGFR) variants associated with non-small cell lung cancer (NSCLC) using purified recombinant EGFR intra… (full text at CIViC) PMID 17332364 · Mulloy et al., 2007 · Open in CIViC	civic
EGFR T790M	(oncogenic)	Oncogenic	D	Supports Oncogenicity	3	submitted	EID12924 In this study, the authors evaluated the oncogenic and signaling effects of the EGFR T790M variant in non-small cell lung cancer (NSCLC), both alone and in cis with activating EGFR variants, including… (full text at CIViC) PMID 17671201 · Godin-Heymann et al., 2007 · Open in CIViC	civic
EGFR T790M	Afatinib	Predictive	B	Supports Resistance	4	accepted	EID1863 Patients with advanced NSCLC and acquired resistance to EGFR TKI (gefitinib or erlotinib) were analyzed for T790M mutations. Of the 70 patients analyzed, 36 (51%) had the T790M mutation and 34 (49%) … (full text at CIViC) PMID 24035188 · Sun et al., 2013 · Open in CIViC	civic
EGFR T790M	Afatinib	Predictive	D	Supports Sensitivity Response	2	accepted	EID2163 In an in vitro study using NCI-H1666 cells (wildtype EGFR) and NCI-H1975 cells (EGFR-L858R/T790M), inhibition of cell growth was used as an assay to determine sensitivity to tyrosine kinase inhibitor … (full text at CIViC) PMID 18408761 · Li et al., 2008 · Open in CIViC	civic
EGFR T790M	Afatinib	Predictive	D	Supports Sensitivity Response	2	accepted	EID2164 In an in vitro study using purified EGFR protein, kinase activity was assayed and compared for wildtype EGFR, EGFR-T790M and EGFR-T790M/L858R using both reversible and irreversible TKI drugs. EFGR pro… (full text at CIViC) PMID 21732342 · Cha et al., 2012 · Open in CIViC	civic
EGFR T790M	Canertinib	Predictive	D	Supports Sensitivity Response	2	accepted	EID2165 In an in vitro study using NCI-H1666 cells (wildtype EGFR) and NCI-H1975 cells (EGFR-L858R/T790M), inhibition of cell growth was used as an assay to determine sensitivity to tyrosine kinase inhibitor … (full text at CIViC) PMID 18408761 · Li et al., 2008 · Open in CIViC	civic
EGFR T790M	Brigatinib + Cetuximab + PanitumumabCombination	Predictive	D	Supports Sensitivity Response	4	submitted	EID4836 Currently, there are no effective therapeutic strategies to overcome the C797S/T790M/activating-mutation (triple-mutation)-mediated EGFR-TKI resistance to Osimertinib. In the present study, we identif… (full text at CIViC) PMID 28287083 · Uchibori et al., 2017 · Open in CIViC	civic
EGFR T790M	Dacomitinib	Predictive	B	Supports Resistance	4	accepted	EID240 In Lung Cancer patients with acquired resistance to Dacomitinib (PF00299804), MET amplification and EGFR T790M were found to be the primary drivers of resistance. PMID 21430269 · Sequist et al., 2011 · Open in CIViC	civic
EGFR T790M	Dacomitinib	Predictive	D	Supports Sensitivity Response	3	accepted	EID2161 In an in vitro study using NCI-H322 cells (wildtype EGFR) and NCI-H1975 cells (EGFR-L858R/T790M), inhibition of cell growth was used as an assay to determine sensitivity to irreversible tyrosine kinas… (full text at CIViC) PMID 18089823 · Engelman et al., 2007 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	A	Supports Resistance	5	accepted	EID238 The T790M mutation in EGFR has been shown to confer resistance to the tyrosine kinase inhibitor erlotinib, and patients harboring this mutation that are placed on the drug are likely to relapse. PMID 25668228 · Denis et al., 2015 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	C	Supports Resistance	—	submitted	EID3807 In a study of 6 patients with progressive non-small cell lung cancer during gefitinib or erlotinib therapy, comparison of DNA sequences from the original diagnostic biopsy specimen and the second bio… (full text at CIViC) PMID 15737014 · Pao et al., 2005 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	D	Supports Sensitivity Response	—	submitted	EID3801 In an in vitro study, a Ba/F3 cell line expressing EGFR S752_I759del demonstrated increased sensitivity to erlotinib treatment (IC50=33nM), comparable to Ba/F3 cells expressing EGFR L858R (a known sen… (full text at CIViC) PMID 17877814 · de Gunst et al., 2007 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	D	Supports Resistance	—	submitted	EID3808 In an in vitro study, a NCI-H1975 cell line expressing EGFR L858R and EGFR T790M co-mutation, EGFR T790M was associated with reduced sensitivity to erlotinib treatment compared to QG56 cells expressin… (full text at CIViC) PMID 25853010 · Abourbeh et al., 2015 · Open in CIViC	civic
EGFR T790M	Erlotinib	Predictive	D	Supports Resistance	—	submitted	EID3809 In an in vitro study, a MCF-7 cell line expressing EGFR L858R and T790M co-mutation demonstrated resistance to erlotinib treatment, compared to MCF-7 cells expressing a known erlotinib sensitizing mut… (full text at CIViC) PMID 21132006 · Harada et al., 2011 · Open in CIViC	civic
EGFR T790M	Erlotinib + PemetrexedCombination	Predictive	C	Supports Sensitivity Response	3	accepted	EID277 In an NSCLC patient initially with L858R mutation, pemetrexed and cisplatin combination treatment was followed by erlotinib treatment. A slow progression developed which was found to be positive for L… (full text at CIViC) PMID 24636847 · Li et al., 2014 · Open in CIViC	civic
EGFR T790M	Gefitinib	Predictive	B	Supports Resistance	3	accepted	EID239 In non-small cell lung cancer, the appearance of T790M mutation leads to resistance to gefitinib. PMID 15728811 · Kobayashi et al., 2005 · Open in CIViC	civic
EGFR T790M	Gefitinib	Predictive	B	Supports Resistance	3	accepted	EID2159 In a study of 14 patients with progressive non-small cell lung cancer during gefitinib treatment, comparison of DNA sequences from the original diagnostic biopsy specimen and the post-treatment biopsy… (full text at CIViC) PMID 17020982 · Kosaka et al., 2006 · Open in CIViC	civic
EGFR T790M	Erlotinib + GefitinibSubstitutes	Predictive	B	Supports Resistance	3	accepted	EID1667 48 tumor samples from 41 patients with EGFR mutant lung adenocarcinoma that were resistant to tyrosine kinase inhibition by gefitinib (n=1) or erlotinib (n=40) underwent next generation sequencing (NG… (full text at CIViC) PMID 27304188 · Belchis et al., 2016 · Open in CIViC	civic
EGFR T790M	Erlotinib + GefitinibSubstitutes	Predictive	C	Supports Resistance	4	accepted	EID2158 In a study of 6 patients with progressive non-small cell lung cancer during gefitinib or erlotinib therapy, comparison of DNA sequences from the original diagnostic biopsy specimen and a post-treatmen… (full text at CIViC) PMID 15737014 · Pao et al., 2005 · Open in CIViC	civic
EGFR T790M	Lapatinib	Predictive	D	Supports Resistance	4	accepted	EID2160 In an in vitro study using NCI-H1666 cells (wildtype EGFR) and NCI-H1975 cells (EGFR-L858R/T790M), inhibition of cell growth was used as an assay to determine sensitivity to reversible tyrosine kinase… (full text at CIViC) PMID 18408761 · Li et al., 2008 · Open in CIViC	civic
EGFR T790M	Lazertinib	Predictive	D	Supports Sensitivity Response	3	submitted	EID12783 An in vitro study treated Ba/F3 murine cells (IL-3 dependent lymphocyte model) to afatinib, a second-generation tyrosine kinase inhibitor (TKI), for several weeks. Secondary resistant mutations to afa… (full text at CIViC) PMID 40940797 · Oiki et al., 2025 · Open in CIViC	civic
EGFR T790M	Mitogen-Activated Protein Kinase Kinase Inhibitor + Naquotinib + OsimertinibSequential	Predictive	D	Supports Resistance	3	submitted	EID6318 Clinical study confirmed a beneficial effect from the combination therapy of MEK inhibitors and naquotinib. Inhibited cell proliferation in both naquotinib-resistant and osimertinib-resistant cells, … (full text at CIViC) PMID 29386539 · Ninomiya et al., 2018 · Open in CIViC	civic
EGFR T790M	Neratinib	Predictive	D	Supports Sensitivity Response	2	accepted	EID2162 The NSCLC cell line NCI-H1975 carrying the EGFR T790M mutation was resistant to erlotinib but showed increased sensitivity to HKI-272 (neratinib, IC50: 0.29 μmol/L). In an in vitro study Ba/F3 cells t… (full text at CIViC) PMID 16818618 · Shimamura et al., 2006 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	A	Supports Sensitivity Response	5	accepted	EID1592 Osimertinib has been approved for the treatment of EGFR T790M mutant NSCLC. PMID 26729184 · Greig, 2016 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	A	Supports Sensitivity Response	5	accepted	EID1867 Randomized, international, open-label, phase 3 trial (NCT02151981) in 419 patients with T790M-positive advanced NSCLC and disease progression after first-line EGFR-TKI therapy. Patients were randomize… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	B	Supports Sensitivity Response	4	accepted	EID965 This phase I/II trial (NCT01802632) involved 253 non-small cell lung cancer patients with activating EGFR mutations, who had progressed on first generation tyrosine kinase inhibitor treatment, and wer… (full text at CIViC) PMID 25923549 · Jänne et al., 2015 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	B	Supports Sensitivity Response	3	accepted	EID966 This study summarized 9 EGFR-mutant patients from two clinical trials involving rociletinib (NCT01526928) and subsequent osimertinib (NCT01802632). 8 were T790M-positive prior to treatment with osimer… (full text at CIViC) PMID 26720284 · Sequist et al., 2016 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	B	Supports Sensitivity Response	—	rejected	EID2166 In a prospective study (NCT01802632) of 253 locally advanced or metastatic, non-small cell lung cancer patients, patients with EGFR T790M mutations treated with osimertinib were associated with improv… (full text at CIViC) PMID 25923549 · Jänne et al., 2015 · Open in CIViC	civic
EGFR T790M	Osimertinib	Predictive	D	Supports Sensitivity Response	3	accepted	EID963 Cell line, xenograft, and transgenic models were used to establish Osimertinib as an inhibitor of both EGFR mutation sensitizing (L858M, del exon 19) and T790M resistance mutants. Preclinically, the d… (full text at CIViC) PMID 24893891 · Cross et al., 2014 · Open in CIViC	civic
EGFR T790M	Osimertinib + RociletinibSubstitutes	Predictive	D	Supports Sensitivity Response	2	accepted	EID967 For cells harboring EGFR T790M mutation, osimertinib and rociletinib showed potent inhibition compared to erlotinib or afatinib. This study performed drug response assays using five human NSCLC cell l… (full text at CIViC) PMID 26515464 · Hirano et al., 2015 · Open in CIViC	civic