Cancer Family
Glandular Cell Neoplasm
CI-CAN-00000188Explore in graph →
- NCIt
- C7132
Loading cancer entity…
Cancer Family
CI-CAN-00000188Explore in graph →
Variants & evidence
847 evidence items mapped to this entity or its descendants, grouped by molecular profile, then therapy. 50 items per page.
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| RAD51 Fusion6 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID5909A 48-year-old Chinese man with right lung tumor and multiple brain metastases of a lung adenocarcinoma (T1N2M1, stage IV). NGS analysis indicated an EGFR-RAD51 fusion rather than the most common kind… (full text at CIViC) PMID 29290255 · Zhu et al., 2018 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | D | Supports Sensitivity Response | 3 | submitted | EID11017Response to Erlotinib was assessed by measuring viability of Ba/F3 cells expressing the EGFR::RAD51 variant 72 hours after treatment with Erlotinib (10-1000 nmol/L). Viabilty was measured using the Ce… (full text at CIViC) PMID 27102076 · Konduri et al., 2016 · Open in CIViC | civic |
| Erlotinib + OsimertinibSequential | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12370This is a case report of 29-year-old diagnosed with metastatic adenocarcinoma of the left lung. The patient was treated with chemotherapy (cisplatin 75 mg/m2 and pemetrexed 500 mg/m2 every 3 weeks) an… (full text at CIViC) PMID 35399574 · Di Federico et al., 2022 · Open in CIViC | civic |
| Icotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | accepted | EID7314A 26 year old non-smoker was diagnosed with lung adenocarcinoma and underwent thoracoscopic resection and treatment with cisplatin and pemetrexed. Panel NGS sequencing of the surgical sample detected … (full text at CIViC) PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID11021Case report of a 30-year-old male with lung adenocarcinoma and metastasis to several organs, including several lesions in the brain. NGS assay (Foundation One CDX panel) detected the EGRF::RAD51 fusio… (full text at CIViC) PMID 35245845 · Copia Sperandio et al., 2022 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12372This is a case report of a 45-year-old male never smoker that was diagnosed with metastatic lung adenocarcinoma. The patient responded poorly to the initial chemoimmunotherapy (carboplatin, pemetrexed… (full text at CIViC) PMID 38525318 · Lai et al., 2024 · Open in CIViC | civic |
| EGFR Rare Mutation1 | ||||||||
| Gefitinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | accepted | EID6186A Japanese Phase III clinical study assessed the noninferiority of gefitinib as compared to erlotinib in 561 advanced stage (IIIB and IV) postoperative lung adenocarcinoma patients. All patients had p… (full text at CIViC) PMID 27022112 · Urata et al., 2016 · Open in CIViC | civic |
| EGFR S7201 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 3 | accepted | EID1782Efficacy of erlotinib treatment was evaluated by meta-analysis of results from seven trials and literature review. Two patients with p.S270P, and one patient with p.S720F were observed to have poor su… (full text at CIViC) PMID 26773740 · Klughammer et al., 2016 · Open in CIViC | civic |
| EGFR S768_D770dup2 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4490In a retrospective study of 46 Caucasian, advanced lung adenocarcinoma patients, a patient harboring EGFR S768_D770insSVD mutation was associated with resistance to erlotinib treatment. The patient su… (full text at CIViC) PMID 27032107 · De Grève et al., 2016 · Open in CIViC | civic |
| Paclitaxel + TislelizumabCombination | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | submitted | EID13094A 48-year-old man with stage IVB lung adenocarcinoma harboring an EGFR S768_D770dup exon 20 insertion and high PD-L1 expression (TPS 50%) received third-line paclitaxel plus tislelizumab after progres… (full text at CIViC) PMID 42558558 · Zhao et al., 2026 · Open in CIViC | civic |
| EGFR S768I3 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID1394A patient with metastatic lung adenocarcinoma was found to harbor EGFR T790M and S768I mutations when acquired resistance developed after 8 years of erlotinib treatment. Analysis of original tumor sam… (full text at CIViC) PMID 25521405 · Hellmann et al., 2014 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | accepted | EID4273In stage IV lung adenocarcinoma patients (n=2) harboring EGFR S768I mutation, EGFR S768I was associated with progressive disease after 1 month of erlotinib monotherapy; the patient was previously trea… (full text at CIViC) PMID 22895145 · Lund-Iversen et al., 2012 · Open in CIViC | civic |
| Gefitinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | accepted | ||
| EGFR G719A + EGFR L861Q + EGFR S768I1 | ||||||||
| Afatinib | Lung Adenocarcinoma | Predictive | A | Supports Sensitivity Response | 3 | accepted | EID11229In a phase 2 trial, 129 patients with lung adenocarcinoma with EGFR mutations including mutations other than exon 19 deletions or exon 21 L858R substitutions who had no more than one previous chemothe… (full text at CIViC) PMID 22452895 · Yang et al., 2012 · Open in CIViC | civic |
| SEPTIN14 Fusion2 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 2 | submitted | EID11005A case report of a 56 year old male with metastatic lung adenocarcinoma to the leptomeninges, in whom two rare EGFR::SEPT14 fusions were identified. On second recurrence, NGS was performed on the CSF,… (full text at CIViC) PMID 34486539 · Zheng et al., 2022 · Open in CIViC | civic |
| Carboplatin + Icotinib + Paclitaxel LiposomeSequential | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | submitted | EID10914Case report of a 62-year-old woman with lung adenocarcinoma. She underwent treatment with liposome-paclitaxel and carboplatin. They detected EGFR-SEPT14 fusion (N-terminal amino acids of EGFR and C-te… (full text at CIViC) PMID 31345345 · Zhu et al., 2019 · Open in CIViC | civic |
| SHC1 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | B | Supports Oncogenicity | 3 | submitted | EID12361This article identified in-frame EGFR-SHC1 fusions in a 61-year-old male smoker with stage IIIA NSCLC, retaining functional kinase domains. RNA-based NGS fusion assays was used for detecting actionabl… (full text at CIViC) PMID 31382039 · Pan et al., 2019 · Open in CIViC | civic |
| SUMF2 Fusion1 | ||||||||
| (prognostic) | Lung Adenocarcinoma | Prognostic | B | Supports Poor Outcome | 3 | submitted | EID12388In this study, the authors employed next-generation sequencing (NGS) to compare the genetic profiles of lung adenocarcinoma (LUAD) patients with and without adrenal metastases. An EGFR-SUMF2 fusion wa… (full text at CIViC) PMID 39673828 · Pan et al., 2025 · Open in CIViC | civic |
| EGFR T725M1 | ||||||||
| Unspecified therapy | Lung Adenocarcinoma | Predictive | D | Supports N/A | 3 | submitted | EID1973T725M and L861R are rare cancer-associated mutations and increase EGFR activity in the absence of the activating EGF ligand in cell-based assays PMID 24743239 · U et al., 2014 · Open in CIViC | civic |
| EGFR T790M6 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | D | Supports Oncogenicity | 3 | accepted | EID12925In this study, the authors investigated the role of the EGFR T790M mutation using inducible mouse lung tumor models expressing T790M alone or in combination with the activating L858R mutation. They de… (full text at CIViC) PMID 17726540 · Regales et al., 2007 · Open in CIViC | civic |
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 3 | submitted | EID12945A 53-year-old Chinese man and lifelong non-smoker presented with chest tightness and pain. CT scans revealed multiple small lung nodules in the right lower lobe were seen with CT scan. Biopsy confirme… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | ||
| EGFR Exon 19 del + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12946A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 1 | accepted | EID1397Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR C797S + EGFR Exon 19 Deletion + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 1 | accepted | EID1396Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFRMET1 | ||||||||
| Capmatinib + OsimertinibCombination | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | submitted | EID11693A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR T790M + EGFR Fusion1 | ||||||||
| Icotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID10895A patient was initially diagnosed with stage IIIA lung adenocarcinoma with EGFR L858R and was treated with lobectomy and adjuvant pemetrexed and cisplatin. 20 months later the patient had recurrent di… (full text at CIViC) PMID 35004270 · Wang et al., 2021 · Open in CIViC | civic |
| EGFR T854A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4282In a lung adenocarcinoma patient with EGFR L858R (a known sensitizing mutation to EGFR tyrosine kinase inhibitor) and EGFR T854A co-mutation, EGFR T854A was reported to be refractory to erlotinib trea… (full text at CIViC) PMID 19010870 · Bean et al., 2008 · Open in CIViC | civic |
| USP42 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 1 | accepted | EID12403One case with presumably EGFR::USP42 fusion was mentioned in OrigiMed database of Chinese patients with lung adenocarcinoma. EGFR breakpoint in intron 27. PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| EGFR V769A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | — | submitted | EID4664In an advanced lung adenocarcinoma patient with EGFR V769A mutation, EGFR V769A was reported to be sensitive to erlotinib treatment. The patient was treated with 1st-line standard chemotherapy, radiot… (full text at CIViC) PMID 24908064 · Xing et al., 2014 · Open in CIViC | civic |
| EGFR V769_D770insASV2 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID1799In this meta-analysis of 7 clinical trials evaluating the efficacy of erlotinib, 1 patient with V769_770insASV had overall and progression-free survival of 642 days. From this and literature review it… (full text at CIViC) PMID 26773740 · Klughammer et al., 2016 · Open in CIViC | civic |
| Gefitinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | submitted | EID4649A 72 year old F never smoker with bronchioloalveolar carcinoma who had previously undergone surgery was tested for mutation in EGFR exons 18 to 21 and had Exon 20 in frame insertion. She was given fir… (full text at CIViC) PMID 22895145 · Lund-Iversen et al., 2012 · Open in CIViC | civic |
| EGFR V774_C775insHV1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4645In a lung adenocarcinoma patient harboring EGFR V774_C775insHV mutation, EGFR V774_C775insHV was associated with lack of response to treatment with erlotinib monotherapy. PMID 23371856 · Arcila et al., 2013 · Open in CIViC | civic |
| VSTM2A Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | E | Supports Oncogenicity | 1 | submitted | EID11103Using NGS, genomic profiling from tumor/plasma biopsies from 17,442 Chinese lung cancer patients was performed. EGFR::VSTM2A reported in 2/1053 recurrent kinase fusions in lung cancer (NSCLC, adenocar… (full text at CIViC) PMID 34508169 · Li et al., 2021 · Open in CIViC | civic |
| EGFR Wildtype1 | ||||||||
| Gefitinib | Lung Adenocarcinoma | Predictive | B | Does Not Support Reduced Sensitivity | 3 | rejected | EID6185In a Japanese Phase III trial, noninferiority of gefitinib in comparison to erlotinib was assessed in lung adenocarcinoma patients with postoperative or recurrent stage IIIb/IV lung adenocarcinoma tre… (full text at CIViC) PMID 27022112 · Urata et al., 2016 · Open in CIViC | civic |
| ZNF713 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 1 | submitted | EID11156This is a case report of a patient with lung adenocarcinoma harboring EGFR::RAD51 fusion, however describes other EGFR fusions in lung adenocarcinoma. The authors examined data from the database of Or… (full text at CIViC) PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| ZNF880 Fusion1 | ||||||||
| Pyrotinib | HER2-Positive Breast CarcinomaALIAS | Predictive | C | Supports Sensitivity Response | 2 | submitted | EID11215Case report describing a 34-year-old female patient without a family history of breast cancer. After a radical mastectomy, histopathology revealed an invasive ductal carcinoma HER2 positive (FISH). Sh… (full text at CIViC) PMID 33371069 · Yue et al., 2020 · Open in CIViC | civic |
| EIF4EBP1 PHOSPHORYLATION1 | ||||||||
| Everolimus | Gastric Adenocarcinoma | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID9188 gastric cancer cell lines were treated with the MTOR inhibitor everolimus. Cell proliferation was effectively inhibited in 3 cell lines by everolimus. Phosphorylated EIF4EBP1 (T37/46, T70) levels we… (full text at CIViC) PMID 23340172 · Nishi et al., 2013 · Open in CIViC | civic |
| ALK e2::e201 | ||||||||
| Unspecified therapy | Renal Cell CarcinomaCURATED_BROADER | Predictive | E | Supports Sensitivity Response | 3 | accepted | EID1266Adenocarcinoma cells were detected via urinary cytology in a 53 year old woman. Cancer morphology suggested papillary renal cell carcinoma (RCC), type 2A. EML4-ALK variant 5 was discovered in tumor t… (full text at CIViC) PMID 22252991 · Sugawara et al., 2012 · Open in CIViC | civic |
| ALK Fusion2 | ||||||||
| Crizotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 4 | accepted | EID262A 28 year-old patient with non-small cell lung cancer that failed conventional therapy was found to harbor the EML4-ALK (E13;A20) fusion using reverse transcription PCR. Treatment with 250mg crizotini… (full text at CIViC) PMID 20979473 · Choi et al., 2010 · Open in CIViC | civic |
| Erlotinib | Lung Acinar Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID1121A 39-year-old man presented was observed to have lung acinar adenocarcinoma. Treatment with chemotherapy produced no remarkable response. A EGFR L858R point mutation was observed; the patient was ther… (full text at CIViC) PMID 23181703 · Tanaka et al., 2012 · Open in CIViC | civic |
| ABCB1 Overexpression + ALK FusionALKABCB12 | ||||||||
| Alectinib + LorlatinibSubstitutes | Lung Adenocarcinoma | Predictive | D | Does Not Support Resistance | 3 | accepted | EID10016EML4-ALK fusion positive lung adenocarcinoma cell lines with high expression of P-gp (ABCB1 gene) (H3122 and the newly established JFCR013-2) were found to be resistant to crizotinib and ceritinib. P-… (full text at CIViC) PMID 26870817 · Katayama et al., 2016 · Open in CIViC | civic |
| Ceritinib + CrizotinibSubstitutes | Lung Adenocarcinoma | Predictive | D | Supports Resistance | 3 | accepted | EID7869EML4-ALK fusion positive lung adenocarcinoma cell lines (H3122 and the newly established JFCR013-2) with high expression of P-gp (ABCB1 gene) were found to be resistant to crizotinib and ceritinib. P… (full text at CIViC) PMID 26870817 · Katayama et al., 2016 · Open in CIViC | civic |
| ALK C1156Y + ALK Fusion2 | ||||||||
| Crizotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 4 | accepted | EID236A 28 year-old patient with T4N3M1 stage lung adenocarcinoma harboring an EML4-ALK variant 1 fusion was treated with crizotinib after failing conventional therapy. The patient achieved a partial respon… (full text at CIViC) PMID 20979473 · Choi et al., 2010 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID4046In a lung adenocarcinoma cancer patient with an EML4-ALK gene rearrangement (a known sensitizing alteration to crizotinib) and an ALK C1156Y co-mutation, ALK C1156Y was reported to be refractory to cr… (full text at CIViC) PMID 27045755 · Saber et al., 2016 · Open in CIViC | civic |
| ALK G1269A + ALK Fusion1 | ||||||||
| Crizotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID4620In a lung adenocarcinoma cancer patient with an EML4-ALK gene rearrangement (a known sensitizing alteration to crizotinib) and an ALK G1269A co-mutation, ALK G1269A was reported to be refractory to cr… (full text at CIViC) PMID 27045755 · Saber et al., 2016 · Open in CIViC | civic |
| ALK L1196M + ALK Fusion1 | ||||||||
| Crizotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 4 | accepted | EID237A 28 year-old patient with non-small cell lung cancer was found to harbor the EML4-ALK (E13;A20) fusion using reverse transcription PCR. Treatment with 250mg crizotinib twice daily resulted in rapid i… (full text at CIViC) PMID 20979473 · Choi et al., 2010 · Open in CIViC | civic |
Data updated 6 minutes agoSource updated unknownsource: civic (CC0)
Evidence levels, directions and ratings are those assigned by CIViC curators. "Submitted" items have not completed curation review. This is not treatment guidance.
EID1395Case report of an 81-year old man with lung adenocarcinoma and EGFR S768I mutation. The patient then received chemotheraoy (vinorelbine) and showed stable disease. Gefitinib was administered when dise… (full text at CIViC) PMID 20522446 · Masago et al., 2010 · Open in CIViC |
| civic |
EID3806In a lung adenocarcinoma patient with EGFR E746_A751>A (a known erlotinib sensitizing mutation) and EGFR T790M co-mutation treated with erlotinib monotherapy, EGFR T790M was associated with disease pr… (full text at CIViC) PMID 17085664 · Balak et al., 2006 · Open in CIViC |
| civic |
| Erlotinib + GefitinibSubstitutes | Lung Adenocarcinoma | Predictive | B | Supports Resistance | 3 | accepted | EID1391155 patients with lung adenocarcinomas underwent rebiopsy and genotyping (EGFR, AKT1, BRAF, ERBB2, KRAS, MEK1, NRAS, PIK3CA and FISH for MET and HER2) after the development of acquired resistance to E… (full text at CIViC) PMID 23470965 · Yu et al., 2013 · Open in CIViC | civic |
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | accepted | EID2157In a lung adenocarcinoma patient harboring an EGFR E746_A750 mutation and an acquired EGFR T790M co-mutation, EGFR T790M was associated with sensitivity to osimertinib monotherapy. Prior to the develo… (full text at CIViC) PMID 26269204 · Planchard et al., 2015 · Open in CIViC | civic |
| 〃 | Pancreatic Adenocarcinoma | Predictive | C | Does Not Support Sensitivity Response | 2 | accepted | EID6006Patients with recurrent pancreatic adenocarcinoma was treated with gemcitabine + nab-paclitaxel, FOLFIRINOX and docetaxel + irinotecan. After failure of these treatment, a tumor specimen from the panc… (full text at CIViC) PMID 28874593 · Cecchini et al., 2017 · Open in CIViC | civic |