Drug · Small Molecule

Capmatinib

CI-DRUG-00000138Explore in graph →NCIt C90564 CHEMBL3188267 CIViC Approved

Regulatory

Approvals (5)

Each record names the authority, jurisdiction, indication text and status. A drug approved in one jurisdiction for one indication is not 'approved' in general.

emaRegulatory1 approval record · authority, jurisdiction and indication text as published.

Jurisdiction · authority	Cancer	Indication	Status	Approval date	Source
EU EMA	Lung Non-Small Cell Carcinoma	Tabrecta as monotherapy is indicated for the treatment of adult patients with advanced non small cell lung cancer (NSCLC) harbouring alterations leading to mesenchymal epithelial transition factor gene exon 14 (METex14) skipping, who require systemic therapy following prior treatment with immunotherapy and/or platinum based chemotherapy.	approved	Jun 20, 2022	ema

Health Canada records are DIN-level: one row per marketed product (brand, strength, form). The Drug Product Database does not publish indications, so no cancer is stated for these rows, and a cancelled or dormant DIN is the status of that one product — not a withdrawal of the molecule.

Data updated 10 hours agoSource updated unknown

Derived

Development pipeline

Most advanced stage across all cancers, then per top-level cancer reached through trial conditions or approval indications. Approval in any ingested jurisdiction outranks trial phase; counts are interventional studies.

Scope	Stage	Max phase	Active	Recruiting	Phase 3	Trials	Approvals	Jurisdictions	First approval	First trial
All cancers	Approved	Phase 4	7	4	5	47	5	CA, EU, US	May 6, 2020	2010-01
Malignant Lung Neoplasm	Approved	Phase 4	3	1	2	21	2	EU, US	May 6, 2020	Apr 5, 2012
Malignant Gastric Neoplasm	Phase3	Phase 3	1	1	1	1	0	—	—	Nov 19, 2024
Cutaneous Melanoma	Phase2	Phase 2	0	0	0	1	0	—

Curated evidence

Clinical evidence (18)

CIViC items in which this therapy appears, grouped by cancer context, then molecular profile. 50 items per page.

civicCuratedShowing 1–18 of 18 evidence items · levels, directions and significance as curated at the source; each row links to its CIViC record.

Therapy	Cancer	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
EGFR Exon 19 Deletion + MET Y1003NMET EGFR1

Clinical trials

Trials with this intervention (51)

Most recently updated first, 50 per page.

clinicaltrialsPublishedShowing 1–50 of 51 studies · status and phase as posted by the registrant; each row links to the study record.

NCT	Title	Status	Phase	Enrollment (n)	Sponsor	Countries	Last update	Source
NCT05488314	A Study of Amivantamab and Capmatinib Combination Therapy in Unresectable Metastatic Non-small Cell Lung Cancer(METalmark)	active not recruiting	Phase 1 / Phase 2	57	Janssen Research & Development, LLCINDUSTRY	13	Sep 25, 2026	clinicaltrials
NCT03040973	Study to Allow Patients Previously Participating in a Novartis Sponsored Trial to Continue Receiving Capmatinib Treatment as Single Agent or in Combination With Other Treatments or the Combination Treatment Alone

Molecule

Record

Kind: Small Molecule
Mechanism: Hepatocyte growth factor receptor inhibitor
Targets: 1 gene
UNII: C2A374O70X
Aliases: 2-Fluoro-N-methyl-4-(7-(quinolin-6-ylmethyl)imidazo[1,2-b][1,2,4]triazin-2-yl)benzamide, Capmatinib, Capmatinib Hydrochloride, CAPMATINIB (INCB28060), INC 280, INC-280, INC280, INCB028060, INCB 28060, INCB-28060, INCB28060, INCB-28060A-1419, INCB-28060 FREE BASE, NVP-INC280, NVP-INC280-NX, NYP-INC280-NX, TABRECTA

Data updated 13 hours agoSource updated unknown

Identifiers

Codes (7)

Upstream identifiers kept as first-class codes; each links to its registry where a stable public URL exists.

System	Code	Label
ATC (WHO)	L01EP01	CAPMATINIB
ATC (WHO)	L01EX17	Antineoplastic agents

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1
Capmatinib + OsimertinibCombination	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	submitted	EID11693 A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1

Capmatinib + OsimertinibCombination

Lung Adenocarcinoma

Predictive

Supports Sensitivity Response

submitted

EID11693

A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC)

PMID 38074875 · Xiang et al., 2023 · Open in CIViC