Publication
Genotype-phenotype correlations in von Hippel-Lindau disease.
Authors not recorded
- Source
- PubMed
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Run
- ING-CIVIC-20260908-000001
Abstract
Abstract (excerpt)
Only the opening of the abstract is shown; abstract text may carry publisher copyright.
Data not yet available
Linked entities
Linked entities (69)
How each link was made (MeSH, dictionary, registry reference, curation…) and whether it has been validated. Candidate links are not counted in entity statistics.
Validated 69
- cancerRenal Cell Carcinomacivic_curation1.00
- geneVHLcivic_curation1.00
- variantVHL A56FS (c.164_165insG)civic_curation1.00
- variantVHL A56fs (c.166dup)civic_curation1.00
- variantVHL C77fs (c.228dup)civic_curation1.00
- variantVHL D197FS (c.589delG)civic_curation1.00
- variantVHL E94* (c.280G>T)civic_curation1.00
- variantVHL F136S (c.407T>C)civic_curation1.00
- variantVHL F76del (c.227_229del)civic_curation1.00
- variantVHL F91* (c.272_273delinsAA)civic_curation1.00
- variantVHL G114C (c.340G>T)civic_curation1.00
- variantVHL G114dup (c.342dupGGT)civic_curation1.00
- variantVHL G123fs (c.369_375delGACACAC)civic_curation1.00
- variantVHL H115P (c.344A>C)civic_curation1.00
- variantVHL H125fs (c.374insA)civic_curation1.00
- variantVHL I151T (c.452T>C)civic_curation1.00
- variantVHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)civic_curation1.00
- variantVHL K159fs (c.474_476delGAAinsC)civic_curation1.00
- variantVHL K196fs (c.584_585delAG)civic_curation1.00
- variantVHL L116V (c.346C>G)civic_curation1.00
- variantVHL L118P (c.353T>C)civic_curation1.00
- variantVHL L128R (c.383T>G)civic_curation1.00
- variantVHL L135fs (c.404del)civic_curation1.00
- variantVHL L153fs (c.457delC)civic_curation1.00
- variantVHL L158V (c.472C>G)civic_curation1.00
- variantVHL L169P (c.506T>C)civic_curation1.00
- variantVHL L178P (c.533T>C)civic_curation1.00
- variantVHL L178R (c.533T>G)civic_curation1.00
- variantVHL L188fs (c.562delC)civic_curation1.00
- variantVHL L89P (c.266T>C)civic_curation1.00
- variantVHL M54fs (c.161dup)civic_curation1.00
- variantVHL N131fs (c.390_391del)civic_curation1.00
- variantVHL N78H (c.232A>C)civic_curation1.00
- variantVHL N78S (c.233A>G)civic_curation1.00
- variantVHL P103FS (c.309_310delTG)civic_curation1.00
- variantVHL P154L (c.461C>T)civic_curation1.00
- variantVHL P59fs (c.176delC)civic_curation1.00
- variantVHL P61FS (c.182_185delCCGT)civic_curation1.00
- variantVHL P86L (c.257C>T)civic_curation1.00
- variantVHL P86R (c.257C>G)civic_curation1.00
- variantVHL P86S (c.256C>T)civic_curation1.00
- variantVHL Q132P (c.395A>C)civic_curation1.00
- variantVHL Q164R (c.491A>G)civic_curation1.00
- variantVHL Q195* (c.583C>T)civic_curation1.00
- variantVHL Q73* (c.217C>T)civic_curation1.00
- variantVHL Q73fs (c.214insGCCC)civic_curation1.00
- variantVHL R113FS (c.337delC)civic_curation1.00
- variantVHL R161Q (c.482G>A)civic_curation1.00
- variantVHL R176fs (c.526del)civic_curation1.00
- variantVHL R177fs (c.528del)civic_curation1.00
- variantVHL R82_V84del (c.243_251del)civic_curation1.00
- variantVHL S65FS (c.194delC)civic_curation1.00
- variantVHL S65L (c.194C>T)civic_curation1.00
- variantVHL S65P (c.193T>C)civic_curation1.00
- variantVHL S65W (c.194C>G)civic_curation1.00
- variantVHL S72fs (c.214del)civic_curation1.00
- variantVHL S72P (c.214T>C)civic_curation1.00
- variantVHL Splice Site (c.341-2A>C)civic_curation1.00
- variantVHL Splice Site (c.464-1G>C)civic_curation1.00
- variantVHL Splice Site (c.464-2A>G)civic_curation1.00
- variantVHL T152fs (c.455insA)civic_curation1.00
- variantVHL T202fs (c.606insA)civic_curation1.00
- variantVHL V155E (c.464T>A)civic_curation1.00
- variantVHL V166F (c.496G>T)civic_curation1.00
- variantVHL V170G (c.509T>G)civic_curation1.00
- variantVHL W88* (c.264G>A)civic_curation1.00
- variantVHL W88R (c.262T>A)civic_curation1.00
- variantVHL Y175* (c.525delC)civic_curation1.00
- variantVHL Y185* (c.555C>G)civic_curation1.00
Curated evidence
Evidence citing this paper (87)
50 items per page.
- Source
- CIViC — Clinical Interpretation of Variants in Cancer
- Dataset
- CIViC evidence items
- Version
- civic-2026-09-08
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Evidence
- expert curation
- License
- CC0 1.0
- PMID
- 17024664
- Run
- ING-CIVIC-20260908-000001
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| VHL Q132P (c.395A>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5131Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Q145* (c.433C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | submitted | EID5132Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Q164R (c.491A>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5133Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Q195* (c.583C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5134Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Q73* (c.217C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5135Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Q73fs (c.214insGCCC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5728Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R113FS (c.337delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 3 | accepted | EID5741Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R161* (c.481C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | submitted | EID8612Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R161Q (c.482G>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5125Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R167Q (c.500G>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID8622Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R167W (c.499C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID8621Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R176fs (c.526del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5166Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R177fs (c.528del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5167Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R82_V84del (c.243_251del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 4 | accepted | EID5726Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S111N (c.332G>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | submitted | EID5021Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S65FS (c.194delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5727Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S65L (c.194C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5159Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This missense mutation was found in 4 VHL families of 11 patients altogether. Ten had retinal hemangioblastomas, 4 … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S65P (c.193T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5160Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S65W (c.194C>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5161Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S72Afs*? (c.213_214insGCCC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID9935Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S72fs (c.214del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5163Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL S72P (c.214T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5162Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Splice Region (c.340+5G>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID8613Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Splice Region (c.463+3A>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | submitted | EID5746Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in 2 unrelated, VHL families with 4 patients total. Three patients had retinal angiomas and… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Splice Site (c.464-1G>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5745Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Splice Site (c.464-2A>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 2 | accepted | EID5724Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This splice mutation was found in a VHL type 1 family of 3 individuals. One family member had retinal angiomas and … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL T124fs (c.369del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | submitted | EID5164Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL T152fs (c.455insA)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5734Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL T202fs (c.606insA)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 3 | accepted | EID5740Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL V155E (c.464T>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5171Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL V166F (c.496G>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5024Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL V170G (c.509T>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5172Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL W117* (c.351G>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID8611Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL W88* (c.264G>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5169Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL W88R (c.262T>A)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5168Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This missense mutation, affecting residue on the surface of pVHL, was found in a VHL type 1 patient with retinal he… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Y175* (c.525delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 3 | accepted | EID5736Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Y185* (c.555C>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5170Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangiobastomas and renal cell carcinoma were higher in patients with nonsense or fra… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |