VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)

CI-VAR-00002065Explore in graph →CIViC 2134

Curated evidence

Evidence by cancer (1 items)

Grouped by cancer context first, then therapy. The same variant can be sensitizing in one cancer and irrelevant in another — contexts are never merged. 50 items per page; a cancer group may continue on the next page.

civicCuratedShowing 1–1 of 1 evidence items across 1 cancer context on this page · levels, directions and significance as curated at the source; each row links to its CIViC record.

Molecular profile	Therapy	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
Von Hippel-Lindau Disease1unmapped disease
VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)	(predisposing)	Predisposing	C	N/A N/A	2	accepted	EID5731 Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in a VHL type 1 family of 3. All three family members had retinal angiomas. One also had re… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC	civic

ClinVar

Clinical significance (0)

ClinVar interpretations are shown as structured records — significance, review status, star rating, conditions — never flattened into one word.

Data not yet available

No ClinVar interpretation attached to this variant.