Publication
Genotype-phenotype correlations in von Hippel-Lindau disease.
Authors not recorded
- Source
- PubMed
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Run
- ING-CIVIC-20260908-000001
Abstract
Abstract (excerpt)
Only the opening of the abstract is shown; abstract text may carry publisher copyright.
Data not yet available
Linked entities
Linked entities (69)
How each link was made (MeSH, dictionary, registry reference, curation…) and whether it has been validated. Candidate links are not counted in entity statistics.
Validated 69
- cancerRenal Cell Carcinomacivic_curation1.00
- geneVHLcivic_curation1.00
- variantVHL A56FS (c.164_165insG)civic_curation1.00
- variantVHL A56fs (c.166dup)civic_curation1.00
- variantVHL C77fs (c.228dup)civic_curation1.00
- variantVHL D197FS (c.589delG)civic_curation1.00
- variantVHL E94* (c.280G>T)civic_curation1.00
- variantVHL F136S (c.407T>C)civic_curation1.00
- variantVHL F76del (c.227_229del)civic_curation1.00
- variantVHL F91* (c.272_273delinsAA)civic_curation1.00
- variantVHL G114C (c.340G>T)civic_curation1.00
- variantVHL G114dup (c.342dupGGT)civic_curation1.00
- variantVHL G123fs (c.369_375delGACACAC)civic_curation1.00
- variantVHL H115P (c.344A>C)civic_curation1.00
- variantVHL H125fs (c.374insA)civic_curation1.00
- variantVHL I151T (c.452T>C)civic_curation1.00
- variantVHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)civic_curation1.00
- variantVHL K159fs (c.474_476delGAAinsC)civic_curation1.00
- variantVHL K196fs (c.584_585delAG)civic_curation1.00
- variantVHL L116V (c.346C>G)civic_curation1.00
- variantVHL L118P (c.353T>C)civic_curation1.00
- variantVHL L128R (c.383T>G)civic_curation1.00
- variantVHL L135fs (c.404del)civic_curation1.00
- variantVHL L153fs (c.457delC)civic_curation1.00
- variantVHL L158V (c.472C>G)civic_curation1.00
- variantVHL L169P (c.506T>C)civic_curation1.00
- variantVHL L178P (c.533T>C)civic_curation1.00
- variantVHL L178R (c.533T>G)civic_curation1.00
- variantVHL L188fs (c.562delC)civic_curation1.00
- variantVHL L89P (c.266T>C)civic_curation1.00
- variantVHL M54fs (c.161dup)civic_curation1.00
- variantVHL N131fs (c.390_391del)civic_curation1.00
- variantVHL N78H (c.232A>C)civic_curation1.00
- variantVHL N78S (c.233A>G)civic_curation1.00
- variantVHL P103FS (c.309_310delTG)civic_curation1.00
- variantVHL P154L (c.461C>T)civic_curation1.00
- variantVHL P59fs (c.176delC)civic_curation1.00
- variantVHL P61FS (c.182_185delCCGT)civic_curation1.00
- variantVHL P86L (c.257C>T)civic_curation1.00
- variantVHL P86R (c.257C>G)civic_curation1.00
- variantVHL P86S (c.256C>T)civic_curation1.00
- variantVHL Q132P (c.395A>C)civic_curation1.00
- variantVHL Q164R (c.491A>G)civic_curation1.00
- variantVHL Q195* (c.583C>T)civic_curation1.00
- variantVHL Q73* (c.217C>T)civic_curation1.00
- variantVHL Q73fs (c.214insGCCC)civic_curation1.00
- variantVHL R113FS (c.337delC)civic_curation1.00
- variantVHL R161Q (c.482G>A)civic_curation1.00
- variantVHL R176fs (c.526del)civic_curation1.00
- variantVHL R177fs (c.528del)civic_curation1.00
- variantVHL R82_V84del (c.243_251del)civic_curation1.00
- variantVHL S65FS (c.194delC)civic_curation1.00
- variantVHL S65L (c.194C>T)civic_curation1.00
- variantVHL S65P (c.193T>C)civic_curation1.00
- variantVHL S65W (c.194C>G)civic_curation1.00
- variantVHL S72fs (c.214del)civic_curation1.00
- variantVHL S72P (c.214T>C)civic_curation1.00
- variantVHL Splice Site (c.341-2A>C)civic_curation1.00
- variantVHL Splice Site (c.464-1G>C)civic_curation1.00
- variantVHL Splice Site (c.464-2A>G)civic_curation1.00
- variantVHL T152fs (c.455insA)civic_curation1.00
- variantVHL T202fs (c.606insA)civic_curation1.00
- variantVHL V155E (c.464T>A)civic_curation1.00
- variantVHL V166F (c.496G>T)civic_curation1.00
- variantVHL V170G (c.509T>G)civic_curation1.00
- variantVHL W88* (c.264G>A)civic_curation1.00
- variantVHL W88R (c.262T>A)civic_curation1.00
- variantVHL Y175* (c.525delC)civic_curation1.00
- variantVHL Y185* (c.555C>G)civic_curation1.00
Curated evidence
Evidence citing this paper (87)
50 items per page.
- Source
- CIViC — Clinical Interpretation of Variants in Cancer
- Dataset
- CIViC evidence items
- Version
- civic-2026-09-08
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Evidence
- expert curation
- License
- CC0 1.0
- PMID
- 17024664
- Run
- ING-CIVIC-20260908-000001
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| VHL I180V (c.538A>G)1 | ||||||||
| (predisposing) | Renal Cell CarcinomaCURATED_BROADER | Predisposing | C | Supports Predisposition | 4 | submitted | EID5142Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL N78H (c.232A>C)1 | ||||||||
| (predisposing) | Renal Cell CarcinomaCURATED_BROADER | Predisposing | C | Supports Predisposition | 4 | accepted | EID5130Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL R177* (c.529A>T)1 | ||||||||
| (predisposing) | Renal Cell CarcinomaCURATED_BROADER | Predisposing | C | Supports Uncertain Significance | 3 | submitted | EID5025Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Splice Site (c.341-2A>C)1 | ||||||||
| (predisposing) | Renal Cell CarcinomaCURATED_BROADER | Predisposing | C | Supports Uncertain Significance | 2 | accepted | EID5730Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in a VHL type 2 patient with retinal angiomas, hemangioblastomas of the central nervous sys… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL A56FS (c.164_165insG)2 | ||||||||
| (diagnostic) | Von Hippel-Lindau DiseaseUNRESOLVED | Diagnostic | B | Supports Positive | 5 | rejected | EID1855c.165insG Frameshift This is another family, with a different genetic background (Chinese) with the same mutation and VHL disease. Affected individuals retinal angioma and central nervous PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID1835c.164insG causes a framehift and truncation allele. One family is described with this allele segregating with disease; 10 affected individuals: 2 patients with renal cell carcinoma, 3 with pheochromo… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL A56fs (c.166dup)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5742Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL C77fs (c.228dup)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5729Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL D197FS (c.589delG)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 3 | accepted | EID5739Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL E134* (c.400G>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | submitted | EID5136Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL E55* (c.162_163insT)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 2 | submitted | EID9934Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL E94* (c.280G>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5137Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Exon Deletion1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | submitted | EID8623Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangiobastomas and renal cell carcinoma were higher in patients with nonsense or fra… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL F136S (c.407T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5152Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL F76del (c.227_229del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5744Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL F91* (c.272_273delinsAA)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5153Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL G104FS (c.309_310delTG)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 3 | submitted | EID9938Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL G114C (c.340G>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5139Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL G114dup (c.342dupGGT)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 2 | accepted | EID5725Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL G123fs (c.369_375delGACACAC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 1 | accepted | EID5732Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL H115P (c.344A>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5140Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL H125fs (c.374insA)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5733Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL I151T (c.452T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5141Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL I75S (c.224T>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 1 | submitted | EID8618Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | N/A N/A | 2 | accepted | EID5731Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in a VHL type 1 family of 3. All three family members had retinal angiomas. One also had re… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL K159fs (c.474_476delGAAinsC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5735Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL K196fs (c.584_585delAG)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 4 | accepted | EID5738Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L116V (c.346C>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5022Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L118P (c.353T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5143Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L128R (c.383T>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5144Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L135fs (c.404del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5165Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L153fs (c.457delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5145Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L158V (c.472C>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5146Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L169P (c.506T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5147Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L178P (c.533T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5149Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L178R (c.533T>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5148Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L188fs (c.562delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Uncertain Significance | 4 | accepted | EID5737Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL L89P (c.266T>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5150Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL M54fs (c.161dup)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5151Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL N131fs (c.390_391del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5128Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL N131T (c.392A>C)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | B | Supports Predisposition | 4 | submitted | EID5129Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL N141fs (c.422del)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | submitted | EID5023Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL N78S (c.233A>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5020Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P103FS (c.309_310delTG)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 3 | accepted | EID5138Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P154L (c.461C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 2 | accepted | EID5154Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P59fs (c.176delC)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5155Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P61FS (c.182_185delCCGT)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5743Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P86L (c.257C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5157Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P86R (c.257C>G)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5156Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |
| VHL P86S (c.256C>T)1 | ||||||||
| (predisposing) | Von Hippel-Lindau DiseaseUNRESOLVED | Predisposing | C | Supports Predisposition | 4 | accepted | EID5158Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC) PMID 17024664 · Ong et al., 2007 · Open in CIViC | civic |