Skip to content
CancerIndex

Publication

Genotype-phenotype correlations in von Hippel-Lindau disease.

Authors not recorded

Hum Mutat2007PMID 17024664stubpubmedProvenance
Source
PubMed
Retrieved
Sep 8, 2026
Layer
normalized (units and labels harmonized; values unchanged)
Run
ING-CIVIC-20260908-000001
Published

Abstract

Abstract (excerpt)

Only the opening of the abstract is shown; abstract text may carry publisher copyright.

Data not yet available

No abstract stored. Read on PubMed

Linked entities

Linked entities (69)

How each link was made (MeSH, dictionary, registry reference, curation…) and whether it has been validated. Candidate links are not counted in entity statistics.

Validated 69

Curated evidence

Evidence citing this paper (87)

50 items per page.

civicProvenance
Source
CIViC — Clinical Interpretation of Variants in Cancer
Dataset
CIViC evidence items
Version
civic-2026-09-08
Retrieved
Sep 8, 2026
Layer
normalized (units and labels harmonized; values unchanged)
Evidence
expert curation
License
CC0 1.0
PMID
17024664
Run
ING-CIVIC-20260908-000001
Open at source
CuratedShowing 1–50 of 87 evidence items · levels, directions and significance as curated at the source; each row links to its CIViC record.
TherapyCancerTypeLevelDirection · significanceRating (1–5)StatusEvidenceSource
VHL I180V (c.538A>G)1
(predisposing)Renal Cell CarcinomaCURATED_BROADERPredisposingCSupports Predisposition4submitted
EID5142

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL N78H (c.232A>C)1
(predisposing)Renal Cell CarcinomaCURATED_BROADERPredisposingCSupports Predisposition4accepted
EID5130

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL R177* (c.529A>T)1
(predisposing)Renal Cell CarcinomaCURATED_BROADERPredisposingCSupports Uncertain Significance3submitted
EID5025

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL Splice Site (c.341-2A>C)1
(predisposing)Renal Cell CarcinomaCURATED_BROADERPredisposingCSupports Uncertain Significance2accepted
EID5730

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in a VHL type 2 patient with retinal angiomas, hemangioblastomas of the central nervous sys… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL A56FS (c.164_165insG)2
(diagnostic)Von Hippel-Lindau DiseaseUNRESOLVEDDiagnosticBSupports Positive5rejected
EID1855

c.165insG Frameshift This is another family, with a different genetic background (Chinese) with the same mutation and VHL disease. Affected individuals retinal angioma and central nervous

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID1835

c.164insG causes a framehift and truncation allele. One family is described with this allele segregating with disease; 10 affected individuals: 2 patients with renal cell carcinoma, 3 with pheochromo… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL A56fs (c.166dup)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5742

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL C77fs (c.228dup)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5729

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL D197FS (c.589delG)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Uncertain Significance3accepted
EID5739

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL E134* (c.400G>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4submitted
EID5136

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL E55* (c.162_163insT)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCN/A N/A2submitted
EID9934

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL E94* (c.280G>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5137

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL Exon Deletion1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3submitted
EID8623

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangiobastomas and renal cell carcinoma were higher in patients with nonsense or fra… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL F136S (c.407T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5152

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL F76del (c.227_229del)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5744

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL F91* (c.272_273delinsAA)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5153

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL G104FS (c.309_310delTG)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCN/A N/A3submitted
EID9938

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL G114C (c.340G>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition2accepted
EID5139

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL G114dup (c.342dupGGT)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCN/A N/A2accepted
EID5725

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL G123fs (c.369_375delGACACAC)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Uncertain Significance1accepted
EID5732

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL H115P (c.344A>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5140

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL H125fs (c.374insA)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5733

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL I151T (c.452T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition2accepted
EID5141

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL I75S (c.224T>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCN/A N/A1submitted
EID8618

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCN/A N/A2accepted
EID5731

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. This mutation was found in a VHL type 1 family of 3. All three family members had retinal angiomas. One also had re… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL K159fs (c.474_476delGAAinsC)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5735

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL K196fs (c.584_585delAG)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Uncertain Significance4accepted
EID5738

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L116V (c.346C>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5022

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L118P (c.353T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5143

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L128R (c.383T>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5144

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L135fs (c.404del)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5165

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal angiomas and renal cell carcinoma were higher in patients with nonsense or frameshift … (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L153fs (c.457delC)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5145

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L158V (c.472C>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5146

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L169P (c.506T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5147

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L178P (c.533T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5149

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L178R (c.533T>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5148

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L188fs (c.562delC)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Uncertain Significance4accepted
EID5737

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL L89P (c.266T>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition2accepted
EID5150

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL M54fs (c.161dup)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5151

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL N131fs (c.390_391del)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5128

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL N131T (c.392A>C)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingBSupports Predisposition4submitted
EID5129

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL N141fs (c.422del)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4submitted
EID5023

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL N78S (c.233A>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5020

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P103FS (c.309_310delTG)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition3accepted
EID5138

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Age-related risks of retinal hemangioblastomas and renal cell carcinoma were higher in patients with nonsense or fr… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P154L (c.461C>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition2accepted
EID5154

Genotype-phenotype correlations of 573 VHL patients from 200 kindreds were analyzed. Higher risk of pheochromocytoma was associated with missense mutations that result in substitution of a surface ami… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P59fs (c.176delC)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5155

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P61FS (c.182_185delCCGT)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5743

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P86L (c.257C>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5157

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P86R (c.257C>G)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5156

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic
VHL P86S (c.256C>T)1
(predisposing)Von Hippel-Lindau DiseaseUNRESOLVEDPredisposingCSupports Predisposition4accepted
EID5158

Genotype-phenotype correlations of 573 VHL patients were analyzed and confirmed that higher risk of pheochromocytoma is associated with missense mutations that result in substitution of a surface amin… (full text at CIViC)

PMID 17024664 · Ong et al., 2007 · Open in CIViC

civic