| VHL has variant …HAS_VARIANTderived200 of 2,756show all (up to 200) |
|---|
| → has variant | F76del (c.227_229del)deletion 19 accepted CIViC evidence items | — | — | not mapped | 19 | Curated | civic | graph → |
| → has variant | R167W (c.499C>T)SNV 18 accepted CIViC evidence items | — | — | not mapped | 18 | Curated | civic | graph → |
| → has variant | R167Q (c.500G>A)SNV 15 accepted CIViC evidence items | — | — | not mapped | 15 | Curated | civic | graph → |
| → has variant | S65W (c.194C>G)SNV 15 accepted CIViC evidence items | — | — | not mapped | 15 | Curated | civic | graph → |
| → has variant | S65L (c.194C>T)SNV 13 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma,Kidney Carcinoma | 13 | Curated | civic | graph → |
| → has variant | R161* (c.481C>T)SNV 12 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 12 | Curated | civic | graph → |
| → has variant | N78S (c.233A>G)SNV 11 accepted CIViC evidence items | — | — | not mapped | 11 | Curated | civic | graph → |
| → has variant | R161Q (c.482G>A)SNV 10 accepted CIViC evidence items | — | — | not mapped | 10 | Curated | civic | graph → |
| → has variant | Q195* (c.583C>T)SNV 9 accepted CIViC evidence items | — | — | not mapped | 9 | Curated | civic | graph → |
| → has variant | Y98H (c.292T>C)SNV 9 accepted CIViC evidence items | — | — | not mapped | 9 | Curated | civic | graph → |
| → has variant | F136S (c.407T>C)SNV 7 accepted CIViC evidence items | — | — | not mapped | 7 | Curated | civic | graph → |
| → has variant | L118P (c.353T>C)SNV 7 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma | 7 | Curated | civic | graph → |
| → has variant | L178P (c.533T>C)SNV 7 accepted CIViC evidence items | — | — | not mapped | 7 | Curated | civic | graph → |
| → has variant | R113* (c.337C>T)SNV 7 accepted CIViC evidence items | — | — | not mapped | 7 | Curated | civic | graph → |
| → has variant | C162W (c.486C>G)SNV 6 accepted CIViC evidence items | — | — | not mapped | 6 | Curated | civic | graph → |
| → has variant | E70K (c.208G>A)SNV 6 accepted CIViC evidence items | — | — | not mapped | 6 | Curated | civic | graph → |
| → has variant | E94* (c.280G>T)SNV 6 accepted CIViC evidence items | — | — | not mapped | 6 | Curated | civic | graph → |
| → has variant | L184P (c.551T>C)SNV 6 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma,Renal Cell Carcinoma | 6 | Curated | civic | graph → |
| → has variant | P86S (c.256C>T)SNV 6 accepted CIViC evidence items | — | — | not mapped | 6 | Curated | civic | graph → |
| → has variant | Splice Site (c.340+1G>A)splice 6 accepted CIViC evidence items | — | — | not mapped | 6 | Curated | civic | graph → |
| → has variant | L158P (c.473T>C)SNV 5 accepted CIViC evidence items | — | — | not mapped | 5 | Curated | civic | graph → |
| → has variant | L89P (c.266T>C)SNV 5 accepted CIViC evidence items | — | — | not mapped | 5 | Curated | civic | graph → |
| → has variant | Mutationother 5 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma,Renal Cell Carcinoma | 5 | Curated | civic | graph → |
| → has variant | Q164* (c.490C>T)SNV 5 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma | 5 | Curated | civic | graph → |
| → has variant | T157I (c.470C>T)SNV 5 accepted CIViC evidence items | — | — | not mapped | 5 | Curated | civic | graph → |
| → has variant | V170D (c.509T>A)SNV 5 accepted CIViC evidence items | — | — | not mapped | 5 | Curated | civic | graph → |
| → has variant | C162F (c.485G>T)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | C162R (c.484T>C)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | C162Y (c.485G>A)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | E70* (c.208G>T)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | Exon 3 Deletiondeletion 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | F119L (c.357C>G)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | I151T (c.452T>C)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | N78H (c.232A>C)SNV 4 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 4 | Curated | civic | graph → |
| → has variant | P154L (c.461C>T)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | S80N (c.239G>A)SNV 4 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 4 | Curated | civic | graph → |
| → has variant | S80R (c.238A>C)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | Splice Site (c.463+2T>C)splice 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | Y156C (c.467A>G)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | Y175* (c.525C>G)SNV 4 accepted CIViC evidence items | — | — | not mapped | 4 | Curated | civic | graph → |
| → has variant | D121G (c.362A>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | Exon 1 Deletiondeletion_cna 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | G114R (c.340G>C)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | G93S (c.277G>A)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | H115Q (c.345C>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | L158V (c.472C>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | L169P (c.506T>C)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | Null (Large deletion)deletion 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | P154= (c.462A>C)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | P81S (c.241C>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | P86L (c.257C>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | Q164R (c.491A>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | Q73* (c.217C>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | Q96* (c.286C>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | R120G (c.358A>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | S183* (c.548C>A)SNV 3 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 3 | Curated | civic | graph → |
| → has variant | Splice Site (c.464-2A>G)splice 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | V166F (c.496G>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | V170G (c.509T>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | V74G (c.221T>G)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | W117C (c.351G>T)SNV 3 accepted CIViC evidence items | — | — | not mapped | 3 | Curated | civic | graph → |
| → has variant | A122I (c.364_365GC>AT)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | A149S (c.445G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | C77fs (c.228dup)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | C77_N78insL (c.230_231insTCT)insertion 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | E160fs (c.479_480delAG)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | E186* (c.556G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | E189fs (c.565del)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | E52K (c.154G>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Exon 1-3 Deletiondeletion_cna 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | F136C (c.407T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | G104A (c.311G>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | G114C (c.340G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | G144* (c.430G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | G93R (c.277G>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | H115R (c.344A>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | H115Y (c.343C>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L128R (c.383T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L135* (c.404T>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L153fs (c.457delC)deletion 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L153P (c.458T>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L178Q (c.533T>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L178R (c.533T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L184R (c.551T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L188P (c.563T>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L188R (c.563T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L188V (c.562C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | L198Q (c.593T>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | M54fs (c.161dup)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | N131fs (c.390_391del)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | N131K (c.393C>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | N131T (c.392A>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | P138T (c.412C>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | P86A (c.256C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | P86R (c.257C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Q132* (c.394C>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Q132P (c.395A>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Q145* (c.433C>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R161G (c.481C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R167L (c.500G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R176fs (c.526del)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R177fs (c.528del)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R82P (c.245G>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | R82_V84del (c.243_251del)deletion 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Rearrangementstructural 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S111C (c.331A>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S111N (c.332G>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S111R (c.333C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S65* (c.194C>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S80I (c.239G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | S80R (c.240T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Splice Site (c.341-2A>C)splice 2 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 2 | Curated | civic | graph → |
| → has variant | Splice Site (c.464-1G>T)splice 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | T105P (c.313A>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | T133fs (c.397del)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | T152fs (c.455insA)indel 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | V130L (c.388G>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | V84L (c.250G>T)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | W88R (c.262T>A)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | W88S (c.263G>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Y112H (c.334T>C)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Y156D (c.466T>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | Y185* (c.555C>G)SNV 2 accepted CIViC evidence items | — | — | not mapped | 2 | Curated | civic | graph → |
| → has variant | 106insR (c.316insGCC)insertion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | *214C (c.641_642insC)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | *214C (c.642A>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | *214G (c.640T>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | *214L (c.641G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | *214W (c.642A>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | 3p26.3-25.3 11Mb deldeletion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | 3'UTR alteration (c.639+10C>G) 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | 3'UTR alteration (c.*70C>A) 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A149fs (c.445del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A149T (c.445G>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A56fs (c.164_165insA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A56FS (c.164_165insG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A56fs (c.166_167insA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A56fs (c.166dup)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | A56_P59del (c.166_178del)deletion 1 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 1 | Curated | civic | graph → |
| → has variant | c.128-?_250+? 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | C162fs (c.483del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | c.−213− ?_463 ?deldeletion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | c.341-59_341-14del 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | C77fs (c.230del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | D121_A122del (c.361_366del)deletion 1 accepted CIViC evidence items | — | — | Clear Cell Renal Cell Carcinoma | 1 | Curated | civic | graph → |
| → has variant | D126FS (c.375_376insC)insertion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | D143fs (c.430delG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | D197FS (c.589delG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | D92G (c.275A>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | Deletiondeletion_cna 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E160fs (c.477del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E186K (c.556G>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E46* (c.136G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E55* (c.163G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E55= (c.165G>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E55FS (c.163_164delGA)indel 1 accepted CIViC evidence items | — | — | Renal Cell Carcinoma | 1 | Curated | civic | graph → |
| → has variant | E55fs (c.163delG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E55RfsTer11 (c.163delG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | E94FS (c.279delC)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | Exon 1-2 Deletiondeletion_cna 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | EXON 2-3 DELETIONdeletion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | Exon 2 Deletiondeletion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | F148* (c.443_455delinsA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | F76fs (c.223_224insT)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | F76S (c.227T>C)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | F91* (c.272_273delinsAA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | F91L (c.273C>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G104= (c.312C>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G104V (c.311G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G114dup (c.342dupGGT) 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G114S (c.340G>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G114Vfs*45 (c.339delA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G123fs (c.369_375delGACACAC)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G144E (c.431G>A)SNV 1 accepted CIViC evidence items | — | — | Adrenal Gland Pheochromocytoma | 1 | Curated | civic | graph → |
| → has variant | G144fs (c.429_439del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G144fs (c.432insG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G93C (c.277G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G93D (c.278G>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G93V (c.278G>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | G93_Y98del (c.275_292del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | H115fs (c.344del)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | H115P (c.344A>C)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | H115Q (c.345C>A)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | H125fs (c.374insA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | H191FS (c.571delC)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | I151F (c.451A>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | I151M (c.453C>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | I180V (c.538A>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)deletion 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | K159fs (c.473dup)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | K159fs (c.474_476delGAAinsC)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | K159fs (c.477_478insCA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | K196* (c.586A>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | K196fs (c.584_585delAG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L101G (c.301_302delinsGG)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L116V (c.346C>G)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L118fs (c.352_353insA)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L128F (c.382C>T)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L129fs (c.384delT)indel 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |
| → has variant | L129P (c.386T>C)SNV 1 accepted CIViC evidence items | — | — | not mapped | 1 | Curated | civic | graph → |