Publication
Presence of MET exon 14 skipping and fusion as mechanism of osimertinb resistance in a lung adenocarcinoma with an EGFR exon 19 deletion that responds to combination of capmatinib and osimertinb: A case report.
Authors not recorded
- Source
- PubMed
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Run
- ING-CIVIC-20260908-000001
Abstract
Abstract (excerpt)
Only the opening of the abstract is shown; abstract text may carry publisher copyright.
Data not yet available
Linked entities
Linked entities (5)
How each link was made (MeSH, dictionary, registry reference, curation…) and whether it has been validated. Candidate links are not counted in entity statistics.
Validated 5
- cancerLung Adenocarcinomacivic_curation1.00
- drugOsimertinibcivic_curation1.00
- geneEGFRcivic_curation1.00
- variantEGFR Exon 19 delcivic_curation1.00
- variantEGFR T790Mcivic_curation1.00
Curated evidence
Evidence citing this paper (3)
- Source
- CIViC — Clinical Interpretation of Variants in Cancer
- Dataset
- CIViC evidence items
- Version
- civic-2026-09-08
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Evidence
- expert curation
- License
- CC0 1.0
- PMID
- 38074875
- Run
- ING-CIVIC-20260908-000001
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| EGFR T790M1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 3 | submitted | EID12945A 53-year-old Chinese man and lifelong non-smoker presented with chest tightness and pain. CT scans revealed multiple small lung nodules in the right lower lobe were seen with CT scan. Biopsy confirme… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR Exon 19 del + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12946A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFRMET1 | ||||||||
| Capmatinib + OsimertinibCombination | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | submitted | EID11693A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |