Drug · Small Molecule

Capmatinib

CI-DRUG-00000138Explore in graph →NCIt C90564 CHEMBL3188267 CIViC Approved

Regulatory

Approvals (5)

Each record names the authority, jurisdiction, indication text and status. A drug approved in one jurisdiction for one indication is not 'approved' in general.

health-canada-dpdRegulatory2 approval records · authority, jurisdiction and indication text as published.

Jurisdiction · authority	Cancer	Indication	Status	Approval date	Source
CA Health Canada	—	Marketed in Canada as TABRECTA (DIN 02527405) under ATC L01EP01 CAPMATINIB. Indications are not published in the Drug Product Database — see the Health Canada Product Monograph.	approvedsource: Marketed	Sep 16, 2022	health-canada-dpd
CA Health Canada	—	Marketed in Canada as TABRECTA (DIN 02527391) under ATC L01EP01 CAPMATINIB. Indications are not published in the Drug Product Database — see the Health Canada Product Monograph.	approvedsource: Marketed	Sep 16, 2022	health-canada-dpd

Health Canada records are DIN-level: one row per marketed product (brand, strength, form). The Drug Product Database does not publish indications, so no cancer is stated for these rows, and a cancelled or dormant DIN is the status of that one product — not a withdrawal of the molecule.

Data updated 14 hours agoSource updated unknown

Derived

Development pipeline

Most advanced stage across all cancers, then per top-level cancer reached through trial conditions or approval indications. Approval in any ingested jurisdiction outranks trial phase; counts are interventional studies.

Scope	Stage	Max phase	Active	Recruiting	Phase 3	Trials	Approvals	Jurisdictions	First approval	First trial
All cancers	Approved	Phase 4	7	4	5	47	5	CA, EU, US	May 6, 2020	2010-01
Malignant Lung Neoplasm	Approved	Phase 4	3	1	2	21	2	EU, US	May 6, 2020	Apr 5, 2012
Malignant Gastric Neoplasm	Phase3	Phase 3	1	1	1	1	0	—	—	Nov 19, 2024
Cutaneous Melanoma	Phase2	Phase 2	0	0	0	1	0	—

Curated evidence

Clinical evidence (18)

CIViC items in which this therapy appears, grouped by cancer context, then molecular profile. 50 items per page.

civicCuratedShowing 1–18 of 18 evidence items · levels, directions and significance as curated at the source; each row links to its CIViC record.

Therapy	Cancer	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
EGFR Exon 19 Deletion + MET Y1003NMET EGFR1

Clinical trials

Trials with this intervention (51)

Most recently updated first, 50 per page.

clinicaltrialsPublishedShowing 51–51 of 51 studies · status and phase as posted by the registrant; each row links to the study record.

NCT	Title	Status	Phase	Enrollment (n)	Sponsor	Countries	Last update	Source
NCT01964235	Study of Efficacy and Safety INC280 in Patients With Advanced Hepatocellular Carcinoma	withdrawn	Phase 2	0	Novartis PharmaceuticalsINDUSTRY	7	Sep 1, 2016	clinicaltrials

Molecule

Record

Kind: Small Molecule
Mechanism: Hepatocyte growth factor receptor inhibitor
Targets: 1 gene
UNII: C2A374O70X
Aliases: 2-Fluoro-N-methyl-4-(7-(quinolin-6-ylmethyl)imidazo[1,2-b][1,2,4]triazin-2-yl)benzamide, Capmatinib, Capmatinib Hydrochloride, CAPMATINIB (INCB28060), INC 280, INC-280, INC280, INCB028060, INCB 28060, INCB-28060, INCB28060, INCB-28060A-1419, INCB-28060 FREE BASE, NVP-INC280, NVP-INC280-NX, NYP-INC280-NX, TABRECTA

Data updated 17 hours agoSource updated unknown

Identifiers

Codes (7)

Upstream identifiers kept as first-class codes; each links to its registry where a stable public URL exists.

System	Code	Label
ATC (WHO)	L01EP01	CAPMATINIB
ATC (WHO)	L01EX17	Antineoplastic agents

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1
Capmatinib + OsimertinibCombination	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	submitted	EID11693 A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC	civic

EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFR MET1

Capmatinib + OsimertinibCombination

Lung Adenocarcinoma

Predictive

Supports Sensitivity Response

submitted

EID11693

A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC)

PMID 38074875 · Xiang et al., 2023 · Open in CIViC

MET Exon 14 Skipping Mutation8
Capmatinib	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	accepted	EID1186 A patient with MET c.3028+1G>T mutation (METex14) had partial response (tumor reduction of 61%) after 13 months capmatinib. MET gene copy number was four, MET FISH 13.8 copy number, and IHC 3+. PMID 25971938 · Frampton et al., 2015 · Open in CIViC	civic
〃	Lung Adenocarcinoma	Predictive	C	Supports Sensitivity Response	3	submitted	EID11417 A 65-year old female (non-smoker) presented with right leg pain and edema. Percutaneous needle biopsy was performed on a mass-like lesion that appeared in a chest x-ray and revealed moderately differe… (full text at CIViC) PMID 36072511 · Kim et al., 2022 · Open in CIViC	civic
〃	Lung Non-Small Cell CarcinomaCURATED_BROADER	Predictive	A	Supports Sensitivity Response	4	accepted	EID8847 In a phase 2 trial, a total of 364 patients with non-small cell lung cancer and MET alterations were assigned to cohorts based on prior treatment and type of MET alteration. A total of 97 patients, fr… (full text at CIViC) PMID 32877583 · Wolf et al., 2020 · Open in CIViC	civic
〃	Lung Non-Small Cell CarcinomaCURATED_BROADER	Predictive	C	Supports Sensitivity Response	3	submitted	EID7795 An 82 year old with metastatic NSCLC had disease recurrence 39 months after complete surgical resection. Genomic profiling of the primary resection harbored a MET variant c.3028G>C, as well as a frame… (full text at CIViC) PMID 25971938 · Frampton et al., 2015 · Open in CIViC	civic
〃	Lung Non-Small Cell CarcinomaCURATED_BROADER	Predictive	C	Supports Adverse Response	2	submitted	EID11409 A 68-year old male (former smoker: 50 pack-years) was diagnosed with stage IV lung adenocarcinoma with pleural disseminations and positive intra-abdominal lymph node. Analysis of tumor tissue showed a… (full text at CIViC) PMID 33347701 · Kanemura et al., 2021 · Open in CIViC	civic
〃	Lung Non-Small Cell CarcinomaCURATED_BROADER	Predictive	D	Supports Sensitivity Response	3	submitted	EID12866 H596 cells harboring mutant c-MET due to exon 14 deletion were shown to be sensitive to capmatinib (INCB28060) inhibiting phospho-c-MET in in vitro ELISA studies. IC50s were 0.4 nM for H596 cells. Cap… (full text at CIViC) PMID 21918175 · Liu et al., 2011 · Open in CIViC	civic
〃	Malignant Lung Neoplasm	Predictive	C	Supports Adverse Response	3	submitted	EID11459 An 84-year old man (smoker) presented with non-small-cell and small-cell lung cancer harboring MET exon 14 skipping mutations and brain metastases. Patient developed progression after eight months of … (full text at CIViC) PMID 34118303 · Mohan et al., 2022 · Open in CIViC	civic
〃	Malignant NeoplasmALIAS	Predictive	D	Supports Sensitivity Response	3	accepted	EID7797 MET exon 14 skipping was modelled in vitro by expressing human MET cDNA with exon 14 deletion in HEK293 cells and mouse MET with homologous exon 15 deletion in NIH3T3 cells. NIH3T3 cells expressing ME… (full text at CIViC) PMID 25971938 · Frampton et al., 2015 · Open in CIViC	civic