Cancer Family
Malignant Thoracic Neoplasm
CI-CAN-00000256Explore in graph →
- NCIt
- C3576
Loading cancer entity…
Cancer Family
CI-CAN-00000256Explore in graph →
Variants & evidence
1,304 evidence items mapped to this entity or its descendants, grouped by molecular profile, then therapy. 50 items per page.
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| EGFR T790M31 | ||||||||
| Erlotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | A | Supports Resistance | 5 | accepted | EID238The T790M mutation in EGFR has been shown to confer resistance to the tyrosine kinase inhibitor erlotinib, and patients harboring this mutation that are placed on the drug are likely to relapse. PMID 25668228 · Denis et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 3 | submitted | EID12945A 53-year-old Chinese man and lifelong non-smoker presented with chest tightness and pain. CT scans revealed multiple small lung nodules in the right lower lobe were seen with CT scan. Biopsy confirme… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID3806In a lung adenocarcinoma patient with EGFR E746_A751>A (a known erlotinib sensitizing mutation) and EGFR T790M co-mutation treated with erlotinib monotherapy, EGFR T790M was associated with disease pr… (full text at CIViC) PMID 17085664 · Balak et al., 2006 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Resistance | — | submitted | EID3807In a study of 6 patients with progressive non-small cell lung cancer during gefitinib or erlotinib therapy, comparison of DNA sequences from the original diagnostic biopsy specimen and the second bio… (full text at CIViC) PMID 15737014 · Pao et al., 2005 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | — | submitted | EID3801In an in vitro study, a Ba/F3 cell line expressing EGFR S752_I759del demonstrated increased sensitivity to erlotinib treatment (IC50=33nM), comparable to Ba/F3 cells expressing EGFR L858R (a known sen… (full text at CIViC) PMID 17877814 · de Gunst et al., 2007 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | — | submitted | EID3808In an in vitro study, a NCI-H1975 cell line expressing EGFR L858R and EGFR T790M co-mutation, EGFR T790M was associated with reduced sensitivity to erlotinib treatment compared to QG56 cells expressin… (full text at CIViC) PMID 25853010 · Abourbeh et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | — | submitted | EID3809In an in vitro study, a MCF-7 cell line expressing EGFR L858R and T790M co-mutation demonstrated resistance to erlotinib treatment, compared to MCF-7 cells expressing a known erlotinib sensitizing mut… (full text at CIViC) PMID 21132006 · Harada et al., 2011 · Open in CIViC | civic |
| Erlotinib + PemetrexedCombination | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID277In an NSCLC patient initially with L858R mutation, pemetrexed and cisplatin combination treatment was followed by erlotinib treatment. A slow progression developed which was found to be positive for L… (full text at CIViC) PMID 24636847 · Li et al., 2014 · Open in CIViC | civic |
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Resistance | 3 | accepted | EID239In non-small cell lung cancer, the appearance of T790M mutation leads to resistance to gefitinib. PMID 15728811 · Kobayashi et al., 2005 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Resistance | 3 | accepted | EID2159In a study of 14 patients with progressive non-small cell lung cancer during gefitinib treatment, comparison of DNA sequences from the original diagnostic biopsy specimen and the post-treatment biopsy… (full text at CIViC) PMID 17020982 · Kosaka et al., 2006 · Open in CIViC | civic |
| Erlotinib + GefitinibSubstitutes | Lung Adenocarcinoma | Predictive | B | Supports Resistance | 3 | accepted | EID1391155 patients with lung adenocarcinomas underwent rebiopsy and genotyping (EGFR, AKT1, BRAF, ERBB2, KRAS, MEK1, NRAS, PIK3CA and FISH for MET and HER2) after the development of acquired resistance to E… (full text at CIViC) PMID 23470965 · Yu et al., 2013 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Resistance | 3 | accepted | EID166748 tumor samples from 41 patients with EGFR mutant lung adenocarcinoma that were resistant to tyrosine kinase inhibition by gefitinib (n=1) or erlotinib (n=40) underwent next generation sequencing (NG… (full text at CIViC) PMID 27304188 · Belchis et al., 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Resistance | 4 | accepted | EID2158In a study of 6 patients with progressive non-small cell lung cancer during gefitinib or erlotinib therapy, comparison of DNA sequences from the original diagnostic biopsy specimen and a post-treatmen… (full text at CIViC) PMID 15737014 · Pao et al., 2005 · Open in CIViC | civic |
| Gefitinib + Multikinase Inhibitor AEE788Sequential | Malignant Lung Neoplasm | Predictive | D | Supports Resistance | 5 | accepted | EID642Lung cancers can accumulate activating mutations in oncogenes such as EGFR. The common L858R EGFR mutation has been shown previously to be sensitive to small molecular tyrosine kinase inhibitors (ie. … (full text at CIViC) PMID 18227510 · Yun et al., 2008 · Open in CIViC | civic |
| Lapatinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | 4 | accepted | EID2160In an in vitro study using NCI-H1666 cells (wildtype EGFR) and NCI-H1975 cells (EGFR-L858R/T790M), inhibition of cell growth was used as an assay to determine sensitivity to reversible tyrosine kinase… (full text at CIViC) PMID 18408761 · Li et al., 2008 · Open in CIViC | civic |
| Lazertinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | submitted | EID12783An in vitro study treated Ba/F3 murine cells (IL-3 dependent lymphocyte model) to afatinib, a second-generation tyrosine kinase inhibitor (TKI), for several weeks. Secondary resistant mutations to afa… (full text at CIViC) PMID 40940797 · Oiki et al., 2025 · Open in CIViC | civic |
| Mitogen-Activated Protein Kinase Kinase Inhibitor + Naquotinib + OsimertinibSequential | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | 3 | submitted | EID6318Clinical study confirmed a beneficial effect from the combination therapy of MEK inhibitors and naquotinib. Inhibited cell proliferation in both naquotinib-resistant and osimertinib-resistant cells, … (full text at CIViC) PMID 29386539 · Ninomiya et al., 2018 · Open in CIViC | civic |
| Neratinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID2162The NSCLC cell line NCI-H1975 carrying the EGFR T790M mutation was resistant to erlotinib but showed increased sensitivity to HKI-272 (neratinib, IC50: 0.29 μmol/L). In an in vitro study Ba/F3 cells t… (full text at CIViC) PMID 16818618 · Shimamura et al., 2006 · Open in CIViC | civic |
| Osimertinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | A | Supports Sensitivity Response | 5 | accepted | EID1592Osimertinib has been approved for the treatment of EGFR T790M mutant NSCLC. PMID 26729184 · Greig, 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | A | Supports Sensitivity Response | 5 | accepted | EID1867Randomized, international, open-label, phase 3 trial (NCT02151981) in 419 patients with T790M-positive advanced NSCLC and disease progression after first-line EGFR-TKI therapy. Patients were randomize… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Sensitivity Response | 4 | accepted | EID965This phase I/II trial (NCT01802632) involved 253 non-small cell lung cancer patients with activating EGFR mutations, who had progressed on first generation tyrosine kinase inhibitor treatment, and wer… (full text at CIViC) PMID 25923549 · Jänne et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Sensitivity Response | 3 | accepted | EID966This study summarized 9 EGFR-mutant patients from two clinical trials involving rociletinib (NCT01526928) and subsequent osimertinib (NCT01802632). 8 were T790M-positive prior to treatment with osimer… (full text at CIViC) PMID 26720284 · Sequist et al., 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Sensitivity Response | — | rejected | EID2166In a prospective study (NCT01802632) of 253 locally advanced or metastatic, non-small cell lung cancer patients, patients with EGFR T790M mutations treated with osimertinib were associated with improv… (full text at CIViC) PMID 25923549 · Jänne et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Squamous Cell Carcinoma | Predictive | C | Supports Sensitivity Response | 4 | submitted | EID12066A 57-year old male with no significant smoking history presented with lung squamous cell carcinoma in the right lung. Oncomine Dx Target Test was done and revealed EGFR exon 19 deletion and de novo EG… (full text at CIViC) PMID 37641467 · Maeda et al., 2023 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 2 | accepted | EID2157In a lung adenocarcinoma patient harboring an EGFR E746_A750 mutation and an acquired EGFR T790M co-mutation, EGFR T790M was associated with sensitivity to osimertinib monotherapy. Prior to the develo… (full text at CIViC) PMID 26269204 · Planchard et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | accepted | EID963Cell line, xenograft, and transgenic models were used to establish Osimertinib as an inhibitor of both EGFR mutation sensitizing (L858M, del exon 19) and T790M resistance mutants. Preclinically, the d… (full text at CIViC) PMID 24893891 · Cross et al., 2014 · Open in CIViC | civic |
| Osimertinib + RociletinibSubstitutes | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID967For cells harboring EGFR T790M mutation, osimertinib and rociletinib showed potent inhibition compared to erlotinib or afatinib. This study performed drug response assays using five human NSCLC cell l… (full text at CIViC) PMID 26515464 · Hirano et al., 2015 · Open in CIViC | civic |
| Rociletinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Sensitivity Response | 4 | accepted | EID646In a phase1-2 study, patients with the T790M mutation were more sensitive to rocelitinib in comparison to patients with T790M-negative NSCLC. PMID 25923550 · Sequist et al., 2015 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Does Not Support Sensitivity Response | 4 | rejected | EID5709Recently, the development of the third-generation epidermal growth factor receptor-small molecule inhibitor (EGFR-TKI) rociletinib had failed. in May 2016, after receiving a negative reply from the … (full text at CIViC) PMID 27785053 · Van Der Steen et al., 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | accepted | EID762CO-1686 (Rociletinib) more effectively induced apoptosis in EGFR mutated (T790M and others) NSCLC cell lines than those harboring wildtype EGFR. CO-1686 also more effectively reduced tumor volume of m… (full text at CIViC) PMID 24065731 · Walter et al., 2013 · Open in CIViC | civic |
| Staurosporine | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | E | Supports Sensitivity Response | 1 | accepted | EID278In NSCLC containing a T790M mutation, staurosporine may be inhibitive of EGFR, especially when an L858R mutation is also present. PMID 24658966 · Ai et al., 2014 · Open in CIViC | civic |
| EGFR Exon 19 del + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12946A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M2 | ||||||||
| Osimertinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | A | Supports Sensitivity Response | 4 | accepted | EID11598This phase 3 trial (NCT02151981) involved 419 patients with EGFR T790M mutant NSCLC who progressed after first-line EGFR inhibitor therapy (gefitinib, erlotinib, or afatinib) and were either treated w… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 1 | accepted | EID1397Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR C797S + EGFR Exon 19 Deletion + EGFR T790M2 | ||||||||
| CH7233163 | Malignant Lung Neoplasm | Predictive | D | Supports Sensitivity Response | 3 | submitted | EID13252The novel tyrosine kinase inhibitor (TKI) CH7233163 has been reported to effectively overcome osimertinib resistance mediated by the EGFR Del19/T790M/C797S triple mutation. In vitro evaluation using e… (full text at CIViC) PMID 32943545 · Kashima et al., 2020 · Open in CIViC | civic |
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 1 | accepted | EID1396Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFRMET1 | ||||||||
| Capmatinib + OsimertinibCombination | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | submitted | EID11693A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR T790M + EGFR Fusion1 | ||||||||
| Icotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID10895A patient was initially diagnosed with stage IIIA lung adenocarcinoma with EGFR L858R and was treated with lobectomy and adjuvant pemetrexed and cisplatin. 20 months later the patient had recurrent di… (full text at CIViC) PMID 35004270 · Wang et al., 2021 · Open in CIViC | civic |
| EGFR T847I1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | accepted | EID4260In a study, 1 participant with stage IIIB lung adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have T847I mutation, and was treated with the 1st generation TKI gefitinib. The pati… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR T854A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4282In a lung adenocarcinoma patient with EGFR L858R (a known sensitizing mutation to EGFR tyrosine kinase inhibitor) and EGFR T854A co-mutation, EGFR T854A was reported to be refractory to erlotinib trea… (full text at CIViC) PMID 19010870 · Bean et al., 2008 · Open in CIViC | civic |
| USP42 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 1 | accepted | EID12403One case with presumably EGFR::USP42 fusion was mentioned in OrigiMed database of Chinese patients with lung adenocarcinoma. EGFR breakpoint in intron 27. PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| EGFR V742A2 | ||||||||
| Erlotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | — | accepted | EID4197In an in vitro study, a Ba/F3 cell line expressing EGFR V742A demonstrated increased sensitivity to erlotinib treatment comparable to Ba/F3 cells expressing a known sensitizing mutation (EGFR L858R). … (full text at CIViC) PMID 19147750 · Kancha et al., 2009 · Open in CIViC | civic |
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | submitted | EID4214In a study, 1 participant with stage IV adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V742A mutation, and was treated with the 1st generation TKI gefitinib. The patient (M,… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V769A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | — | submitted | EID4664In an advanced lung adenocarcinoma patient with EGFR V769A mutation, EGFR V769A was reported to be sensitive to erlotinib treatment. The patient was treated with 1st-line standard chemotherapy, radiot… (full text at CIViC) PMID 24908064 · Xing et al., 2014 · Open in CIViC | civic |
| EGFR V769_D770insASV3 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID1799In this meta-analysis of 7 clinical trials evaluating the efficacy of erlotinib, 1 patient with V769_770insASV had overall and progression-free survival of 642 days. From this and literature review it… (full text at CIViC) PMID 26773740 · Klughammer et al., 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Resistance | 3 | submitted | EID5943A 60 year old female former smoker with 2 pack years and EGFR V769_D770insASV lung adenocarcinoma patient was given erlotinib as first line treatment, and had progressive disease as best response with… (full text at CIViC) PMID 24353160 · Yasuda et al., 2013 · Open in CIViC | civic |
| Gefitinib | Lung Adenocarcinoma | Predictive | C | Supports | ||||
| EGFR V769L or V769M1 | ||||||||
| Afatinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | 3 | submitted | EID12784An in vitro study treated Ba/F3 murine cells (IL-3 dependent lymphocyte model) to afatinib, a second-generation tyrosine kinase inhibitor (TKI), for several weeks. Secondary resistant mutations to afa… (full text at CIViC) PMID 40940797 · Oiki et al., 2025 · Open in CIViC | civic |
| EGFR V774A1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID4226In a study, 1 participant with stage IV adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V774A mutation, and was treated with the 1st generation TKI gefitinib. The patient (F,… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V774_C775insHV1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4645In a lung adenocarcinoma patient harboring EGFR V774_C775insHV mutation, EGFR V774_C775insHV was associated with lack of response to treatment with erlotinib monotherapy. PMID 23371856 · Arcila et al., 2013 · Open in CIViC | civic |
Data updated 20 minutes agoSource updated unknownsource: civic (CC0)
Evidence levels, directions and ratings are those assigned by CIViC curators. "Submitted" items have not completed curation review. This is not treatment guidance.
| 2 |
| submitted |
EID4649A 72 year old F never smoker with bronchioloalveolar carcinoma who had previously undergone surgery was tested for mutation in EGFR exons 18 to 21 and had Exon 20 in frame insertion. She was given fir… (full text at CIViC) PMID 22895145 · Lund-Iversen et al., 2012 · Open in CIViC |
| civic |