Loading cancer entity…
Loading cancer entity…
Variants & evidence
1,206 evidence items mapped to this entity or its descendants, grouped by molecular profile, then therapy. 50 items per page.
| Therapy | Cancer | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| EGFR T790M2 | ||||||||
| Rociletinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | accepted | EID762CO-1686 (Rociletinib) more effectively induced apoptosis in EGFR mutated (T790M and others) NSCLC cell lines than those harboring wildtype EGFR. CO-1686 also more effectively reduced tumor volume of m… (full text at CIViC) PMID 24065731 · Walter et al., 2013 · Open in CIViC | civic |
| Staurosporine | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | E | Supports Sensitivity Response | 1 | accepted | EID278In NSCLC containing a T790M mutation, staurosporine may be inhibitive of EGFR, especially when an L858R mutation is also present. PMID 24658966 · Ai et al., 2014 · Open in CIViC | civic |
| EGFR Exon 19 del + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID12946A 53-year-old Chinese man, a lifelong non-smoker, presented with chest tightness and pain. CT imaging revealed multiple small nodules in the right lower lobe of the lung. A biopsy confirmed stage IV l… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M2 | ||||||||
| Osimertinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | A | Supports Sensitivity Response | 4 | accepted | EID11598This phase 3 trial (NCT02151981) involved 419 patients with EGFR T790M mutant NSCLC who progressed after first-line EGFR inhibitor therapy (gefitinib, erlotinib, or afatinib) and were either treated w… (full text at CIViC) PMID 27959700 · Mok et al., 2017 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 1 | accepted | EID1397Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR C797S + EGFR Exon 19 Deletion + EGFR T790M1 | ||||||||
| Osimertinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 1 | accepted | EID1396Case report of a patient with stage IV lung adenocarcinoma and a 15–base pair deletion in EGFR exon 19. Partial response with erlotinib was achieved for 15 months after initial chemotherapy. After fur… (full text at CIViC) PMID 26181354 · Yu et al., 2015 · Open in CIViC | civic |
| EGFR Exon 19 Deletion + EGFR T790M + MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTCEGFRMET1 | ||||||||
| Capmatinib + OsimertinibCombination | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | submitted | EID11693A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
| EGFR T790M + EGFR Fusion1 | ||||||||
| Icotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID10895A patient was initially diagnosed with stage IIIA lung adenocarcinoma with EGFR L858R and was treated with lobectomy and adjuvant pemetrexed and cisplatin. 20 months later the patient had recurrent di… (full text at CIViC) PMID 35004270 · Wang et al., 2021 · Open in CIViC | civic |
| EGFR T847I1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | accepted | EID4260In a study, 1 participant with stage IIIB lung adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have T847I mutation, and was treated with the 1st generation TKI gefitinib. The pati… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR T854A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4282In a lung adenocarcinoma patient with EGFR L858R (a known sensitizing mutation to EGFR tyrosine kinase inhibitor) and EGFR T854A co-mutation, EGFR T854A was reported to be refractory to erlotinib trea… (full text at CIViC) PMID 19010870 · Bean et al., 2008 · Open in CIViC | civic |
| USP42 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 1 | accepted | EID12403One case with presumably EGFR::USP42 fusion was mentioned in OrigiMed database of Chinese patients with lung adenocarcinoma. EGFR breakpoint in intron 27. PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| EGFR V742A2 | ||||||||
| Erlotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | — | accepted | EID4197In an in vitro study, a Ba/F3 cell line expressing EGFR V742A demonstrated increased sensitivity to erlotinib treatment comparable to Ba/F3 cells expressing a known sensitizing mutation (EGFR L858R). … (full text at CIViC) PMID 19147750 · Kancha et al., 2009 · Open in CIViC | civic |
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | submitted | EID4214In a study, 1 participant with stage IV adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V742A mutation, and was treated with the 1st generation TKI gefitinib. The patient (M,… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V769A1 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | — | submitted | EID4664In an advanced lung adenocarcinoma patient with EGFR V769A mutation, EGFR V769A was reported to be sensitive to erlotinib treatment. The patient was treated with 1st-line standard chemotherapy, radiot… (full text at CIViC) PMID 24908064 · Xing et al., 2014 · Open in CIViC | civic |
| EGFR V769_D770insASV3 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID1799In this meta-analysis of 7 clinical trials evaluating the efficacy of erlotinib, 1 patient with V769_770insASV had overall and progression-free survival of 642 days. From this and literature review it… (full text at CIViC) PMID 26773740 · Klughammer et al., 2016 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Resistance | 3 | submitted | EID5943A 60 year old female former smoker with 2 pack years and EGFR V769_D770insASV lung adenocarcinoma patient was given erlotinib as first line treatment, and had progressive disease as best response with… (full text at CIViC) PMID 24353160 · Yasuda et al., 2013 · Open in CIViC | civic |
| Gefitinib | Lung Adenocarcinoma | Predictive | C | Supports | ||||
| EGFR V769L or V769M1 | ||||||||
| Afatinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | 3 | submitted | EID12784An in vitro study treated Ba/F3 murine cells (IL-3 dependent lymphocyte model) to afatinib, a second-generation tyrosine kinase inhibitor (TKI), for several weeks. Secondary resistant mutations to afa… (full text at CIViC) PMID 40940797 · Oiki et al., 2025 · Open in CIViC | civic |
| EGFR V774A1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID4226In a study, 1 participant with stage IV adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V774A mutation, and was treated with the 1st generation TKI gefitinib. The patient (F,… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V774_C775insHV2 | ||||||||
| Erlotinib | Lung Adenocarcinoma | Predictive | C | Supports Resistance | — | submitted | EID4645In a lung adenocarcinoma patient harboring EGFR V774_C775insHV mutation, EGFR V774_C775insHV was associated with lack of response to treatment with erlotinib monotherapy. PMID 23371856 · Arcila et al., 2013 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | 3 | submitted | EID5809MCF-7 cells were transduced with YFP tagged EGFR with D770_N771INSSVD mutation, or YFP EGFR wildtype, and stained for ectopic YFP EGFR and phospho-Akt as a readout for EGFR pathway activity. Increased… (full text at CIViC) PMID 17877814 · de Gunst et al., 2007 · Open in CIViC | civic |
| EGFR V774M1 | ||||||||
| Erlotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | accepted | EID4231In a study, 1 participant with stage IV squamous cell lung carcinoma was sequenced at EGFR exons 18 to 21 and was found to have V774M mutation, and was treated with the 1st generation TKI erlotinib. T… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V834I1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 3 | accepted | EID4248In a study, 1 participant with stage IIIB lung adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V834I mutation, and was treated with the 1st generation TKI gefitinib. The pati… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| EGFR V851I1 | ||||||||
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 2 | accepted | EID4264In a study, 1 participant with stage IV lung adenocarcinoma was sequenced at EGFR exons 18 to 21 and was found to have V851I mutation, and was treated with the 1st generation TKI gefitinib. The patien… (full text at CIViC) PMID 21531810 · Wu et al., 2011 · Open in CIViC | civic |
| VSTM2A Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | E | Supports Oncogenicity | 1 | submitted | EID11103Using NGS, genomic profiling from tumor/plasma biopsies from 17,442 Chinese lung cancer patients was performed. EGFR::VSTM2A reported in 2/1053 recurrent kinase fusions in lung cancer (NSCLC, adenocar… (full text at CIViC) PMID 34508169 · Li et al., 2021 · Open in CIViC | civic |
| EGFR Wildtype3 | ||||||||
| Deguelin | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | submitted | EID12204Deguelin inhibits EGFR signaling in wild-type NSCLC cells. It reduces EGFR phosphorylation and downstream signalling, as shown by decreased phosphorylation of Akt and ERK1/2. This effect was not obser… (full text at CIViC) PMID 32081857 · Gao et al., 2020 · Open in CIViC | civic |
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Resistance | 4 | accepted | EID2512In a phase 3 clinical trial of East Asian pulmonary adenocarcinoma patients, a subset of patients with EGFR mutations (n=261) treated with gefitinib were associated with improved response compared to … (full text at CIViC) PMID 19692680 · Mok et al., 2009 · Open in CIViC | civic |
| 〃 | Lung Adenocarcinoma | Predictive | ||||||
| EGFR Y1092 PHOSPHORYLATION1 | ||||||||
| Erlotinib + GefitinibSubstitutes | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | B | Supports Sensitivity Response | 3 | accepted | EID923While EGFR mutation is a strong predictive factor for EGFR inhibition, some patients with EGFR wild-type also respond. The authors investigated whether phosphorylated EGFR could be a potential predic… (full text at CIViC) PMID 22901364 · Wang et al., 2012 · Open in CIViC | civic |
| EGFR Y764_V765insHH2 | ||||||||
| Erlotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Resistance | — | accepted | EID4800In an in vitro study, a Ba/F3 cell line expressing EGFR Y764_V765insHH demonstrated reduced sensitivity to erlotinib treatment (IC50=3.845�M), comparable to Ba/F3 cells expressing EGFR L858R and T790M… (full text at CIViC) PMID 24353160 · Yasuda et al., 2013 · Open in CIViC | civic |
| Gefitinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Does Not Support Sensitivity Response | 3 | submitted | EID5937A 66 year old male with 10 pack year smoking history and lung adenocarcinoma with EGFR Y764_V765insHH mutation was given gefitinib as first line treatment, and had stable disease as best response with… (full text at CIViC) PMID 24353160 · Yasuda et al., 2013 · Open in CIViC | civic |
| YAP1 Fusion1 | ||||||||
| (oncogenic) | Lung Non-Small Cell CarcinomaCURATED_BROADER | Oncogenic | C | Supports Oncogenicity | 1 | submitted | EID11159An EGFR::YAP1 fusion was reported in a patient with non-small cell lung cancer. The breakpoint in EGFR is given as exon 26. Breakpoint in YAP1 is not specified. PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| ZNF713 Fusion1 | ||||||||
| (oncogenic) | Lung Adenocarcinoma | Oncogenic | C | Supports Oncogenicity | 1 | submitted | EID11156This is a case report of a patient with lung adenocarcinoma harboring EGFR::RAD51 fusion, however describes other EGFR fusions in lung adenocarcinoma. The authors examined data from the database of Or… (full text at CIViC) PMID 31064887 · Guan et al., 2019 · Open in CIViC | civic |
| ALK e20::e203 | ||||||||
| Crizotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 2 | accepted | EID1189In the PROFILE 1001 study, from 31 NSCLC tumors positive for ALK fusions with sufficient material for RT-PCR aided exon breakpoint identification, 1 case of EML4-ALK variant 2 (EML4 exon 20 fused to A… (full text at CIViC) PMID 20979469 · Kwak et al., 2010 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID1196EML4-ALK variants v1 (E13;A20), v2 (E20;A20), v3a (E6;A20) and v3b (E6ins33;A20) were expressed in Ba/F3 cells using retrovirus. While all constructs rendered Ba/F3 cells IL3-independant, marked diff… (full text at CIViC) PMID 22912387 · Heuckmann et al., 2012 · Open in CIViC | civic |
| Alvespimycin + CrizotinibCombination | ||||||||
| ALK e2::e201 | ||||||||
| Crizotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | E | Supports Sensitivity Response | 4 | accepted | EID1190Multiplex RT-PCR to detect in-frame fusions of EML4 to ALK was performed on total RNA from 253 lung adenocarcinomas, and 9 samples were found to contain such fusions, one of which was a novel fusion c… (full text at CIViC) PMID 18927303 · Takeuchi et al., 2008 · Open in CIViC | civic |
| ALK e6::e207 | ||||||||
| 2,4-pyrimidinediamine | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 4 | accepted | EID1192In a cohort of 75 NSCLC patients that had tested positive for 3 EML4-ALK rearrangements, two individuals were identified via RT-PCR with a novel EML4-ALK translocation involving the first 6 exons of E… (full text at CIViC) PMID 18593892 · Choi et al., 2008 · Open in CIViC | civic |
| ALK Inhibitor TAE684 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID1194In a panel of 602 cancer cell lines, 3/134 NSCLC cell lines showed <0.5% cell viability following treatment with the ALK inhibitor TAE684. Of these, NCI-H2228 harbored EML4-ALK variant 3a/b (EML4 exon… (full text at CIViC) PMID 18451166 · McDermott et al., 2008 · Open in CIViC | civic |
| 〃 | ||||||||
| ALK Fusion6 | ||||||||
| Crizotinib | Lung Adenocarcinoma | Predictive | C | Supports Sensitivity Response | 4 | accepted | EID262A 28 year-old patient with non-small cell lung cancer that failed conventional therapy was found to harbor the EML4-ALK (E13;A20) fusion using reverse transcription PCR. Treatment with 250mg crizotini… (full text at CIViC) PMID 20979473 · Choi et al., 2010 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 4 | accepted | EID1207In the PROFILE 1001 study of crizotinib in 82 patients with ALK-rearranged NSCLC, 31 patients with sufficient tumor material were tested using RT-PCR for the presence of certain EML4-ALK variants. 13… (full text at CIViC) PMID 20979469 · Kwak et al., 2010 · Open in CIViC | civic |
| Alvespimycin + CrizotinibCombination | Lung Non-Small Cell CarcinomaCURATED_BROADER | |||||||
Data updated 10 hours agoSource updated unknownsource: civic (CC0)
Evidence levels, directions and ratings are those assigned by CIViC curators. "Submitted" items have not completed curation review. This is not treatment guidance.
| 2 |
| submitted |
EID4649A 72 year old F never smoker with bronchioloalveolar carcinoma who had previously undergone surgery was tested for mutation in EGFR exons 18 to 21 and had Exon 20 in frame insertion. She was given fir… (full text at CIViC) PMID 22895145 · Lund-Iversen et al., 2012 · Open in CIViC |
| civic |
| B |
| Does Not Support Reduced Sensitivity |
| 3 |
| rejected |
EID6185In a Japanese Phase III trial, noninferiority of gefitinib in comparison to erlotinib was assessed in lung adenocarcinoma patients with postoperative or recurrent stage IIIb/IV lung adenocarcinoma tre… (full text at CIViC) PMID 27022112 · Urata et al., 2016 · Open in CIViC |
| civic |
| Lung Non-Small Cell CarcinomaCURATED_BROADER |
| Predictive |
| D |
| Supports Sensitivity Response |
| 2 |
| accepted |
EID1204EML4-ALK fusions occur in 2-7% of lung adenocarcinomas. Transduction of Ba/F3 cells with EML4-ALK variant 2 (EML4 exon 20 fused to ALK exon 20) caused the cells to grow independently of IL3 addition. … (full text at CIViC) PMID 22912387 · Heuckmann et al., 2012 · Open in CIViC |
| civic |
| Predictive |
| D |
| Does Not Support Sensitivity Response |
| 2 |
| accepted |
EID1195Exon-array and RT-PCR was used to screen a panel of 83 NSCLC cell lines for EML4-ALK variants. The cell lines NCI-H3122 (containing EML4-ALK variant 1) and NCI-H2228 (containing the EML4 exon 6 and AL… (full text at CIViC) PMID 18594010 · Koivunen et al., 2008 · Open in CIViC |
| civic |
| Alvespimycin | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Does Not Support Sensitivity Response | 2 | accepted | EID1205Transduction of Ba/F3 cells with EML4-ALK variant 3a caused the cells to grow independently of IL3 addition. While incubation of Ba/F3 cells transduced with EML4-ALK variants 1 and 2 with Hsp90 inhib… (full text at CIViC) PMID 22912387 · Heuckmann et al., 2012 · Open in CIViC | civic |
| Ceritinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 3 | accepted | EID1340Ceritinib was 28x more potent (GI50 3.8nM) than crizotinib (GI50 107nM) at inhibiting growth of H2228, an NSCLC cell line which harbors the EML4-ALK variant 3a/3b. SCID mice xenografted with H2228 we… (full text at CIViC) PMID 24675041 · Friboulet et al., 2014 · Open in CIViC | civic |
| Crizotinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | C | Supports Sensitivity Response | 4 | accepted | EID1193In a set of 31 patients with NSCLC, RT-PCR was performed to test for known EML4-ALK variants. Five patients tested positive for the 3a/3b EML4-ALK variant. Of these, 4 had partial response (PR), and… (full text at CIViC) PMID 20979469 · Kwak et al., 2010 · Open in CIViC | civic |
| 〃 | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Does Not Support Sensitivity Response | 2 | accepted | EID1197Ba/F3 cells transduced with EML4-ALK variants v1 (E13;A20), v2 (E20;A20), v3a (E6;A20) and v3b (E6ins33;A20) showed differential sensitivity to both crizotinib and TAE684, with variant 3a (E6;A20) bei… (full text at CIViC) PMID 22912387 · Heuckmann et al., 2012 · Open in CIViC | civic |
| Predictive |
| D |
| Supports Sensitivity Response |
| 2 |
| accepted |
EID1206Transduction of Ba/F3 cells with EML4-ALK variant 1 causes IL3 independent growth. Incubation of EML4-ALK variant 1 transduced Ba/F3 cells with Hsp90 inhibitor 17-DMAG caused cell death that was rever… (full text at CIViC) PMID 22912387 · Heuckmann et al., 2012 · Open in CIViC |
| civic |
| Crizotinib + Retaspimycin HydrochlorideCombination | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 4 | accepted | EID1203In preclinical work using H3122 NSCLC cells which contain the EML4-ALK variant 1, administration of the Hsp90 inhibitor IPI-504 caused marked decrease of EML4-ALK protein levels at concentrations lowe… (full text at CIViC) PMID 21258415 · Normant et al., 2011 · Open in CIViC | civic |
| Erlotinib | Lung Acinar Adenocarcinoma | Predictive | C | Supports Resistance | 2 | accepted | EID1121A 39-year-old man presented was observed to have lung acinar adenocarcinoma. Treatment with chemotherapy produced no remarkable response. A EGFR L858R point mutation was observed; the patient was ther… (full text at CIViC) PMID 23181703 · Tanaka et al., 2012 · Open in CIViC | civic |
| Lorlatinib | Lung Non-Small Cell CarcinomaCURATED_BROADER | Predictive | D | Supports Sensitivity Response | 2 | accepted | EID1332EML4-ALK variant 1 containing H-3122 NSCLC cells were treated with second generation ALK inhibitor PF-06463922. PF-06463922 was 125x more potent at reducing cell viability than crizotinib. Control neu… (full text at CIViC) PMID 26554404 · Infarinato et al., 2016 · Open in CIViC | civic |