Variant · Splice
MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTC
CI-VAR-00004200Explore in graph →CIViC 4642
Curated evidence
Evidence by cancer (1 items)
Grouped by cancer context first, then therapy. The same variant can be sensitizing in one cancer and irrelevant in another — contexts are never merged. 50 items per page; a cancer group may continue on the next page.
civicProvenance
- Source
- CIViC — Clinical Interpretation of Variants in Cancer
- Dataset
- CIViC evidence items
- Version
- civic-2026-09-08
- Retrieved
- Sep 8, 2026
- Layer
- normalized (units and labels harmonized; values unchanged)
- Evidence
- expert curation
- License
- CC0 1.0
- PMID
- 38074875
- Run
- ING-CIVIC-20260908-000001
| Molecular profile | Therapy | Type | Level | Direction · significance | Rating (1–5) | Status | Evidence | Source |
|---|---|---|---|---|---|---|---|---|
| Lung Adenocarcinoma1 | ||||||||
| EGFR T790M AND EGFR Exon 19 Deletion AND MET Splice Site (c.3027_3028+21delAGGTATATTTCAGTTTATTGTTC | Capmatinib + OsimertinibCombination | Predictive | C | Supports Sensitivity Response | 3 | submitted | EID11693A 53-year old man (non-smoker) presented with chest tightness and pain and was revealed to have stage IV lung adenocarcinoma with EGFR exon 19 deletion. The patient started first-line Erlotinib at 150… (full text at CIViC) PMID 38074875 · Xiang et al., 2023 · Open in CIViC | civic |
ClinVar
Clinical significance (0)
ClinVar interpretations are shown as structured records — significance, review status, star rating, conditions — never flattened into one word.
Data not yet available
No ClinVar interpretation attached to this variant.