KIT K550_W557del

CI-VAR-00002138Explore in graph →ENST00000288135.5:c.1648_1671del AAACCCATGTATGAAGTACAGTGGCIViC 948

Curated evidence

Evidence by cancer (2 items)

Grouped by cancer context first, then therapy. The same variant can be sensitizing in one cancer and irrelevant in another — contexts are never merged. 50 items per page; a cancer group may continue on the next page.

civicCuratedShowing 1–2 of 2 evidence items across 1 cancer context on this page · levels, directions and significance as curated at the source; each row links to its CIViC record.

Molecular profile	Therapy	Type	Level	Direction · significance	Rating (1–5)	Status	Evidence	Source
Gastrointestinal Stromal Tumor2
KIT K550_W557del	Imatinib	Predictive	D	Supports Sensitivity Response	—	submitted	EID2395 Molecular models predict that deletion of a portion of the juxtamembrane domain relieves steric hindrance and results in higher binding affinity for imatinib. PMID 21364689 · Pierotti et al., 2011 · Open in CIViC	civic
KIT K550_W557del	Imatinib + Ponatinib + Regorafenib + SunitinibSubstitutes	Predictive	D	Supports Sensitivity Response	2	accepted	EID4583 In an in vitro study, an IL3 independent Ba/F3 cell line expressing KIT K550_W557del primary activating mutation demonstrated sensitivity to imatinib (IC50: 13nmol/L), sunitinib (IC50: 5nmol/L), regor… (full text at CIViC) PMID 25239608 ·

ClinVar

Clinical significance (0)

ClinVar interpretations are shown as structured records — significance, review status, star rating, conditions — never flattened into one word.

Data not yet available

No ClinVar interpretation attached to this variant.