Knowledge graph · Variant
VHL Intronic deletion (c.341-13delCGTTTCCAACAATTTCTCGGTGT)
deletion
- Identifier
- CI-VAR-00002065
- Edges
- 0
- Neighbours
- none
- Drawn
- 0 of 0 neighbours (cap 60); table lists every fetched edge
Accepted: cancer:<slug>, gene:<symbol>, variant:<slug>, drug:<slug>, trial:<NCT id>, or a bare CI id. Find slugs with search.
Most connectedLung Non-Small Cell Carcinoma 3,147Malignant Colorectal Neoplasm 1,866ABL1 298EGFR 276Imatinib 450Dasatinib 321
Data not yet available
No knowledge edge or registry link touches this variant on this environment. Edges appear once a source (CIViC, ChEMBL, openFDA, ClinicalTrials.gov, GDC) states one — CancerIndex does not infer them.