Knowledge graph · Gene
AKAP1
A-kinase anchoring protein 1
- Identifier
- CI-GENE-00000806
- Entity page
- /gene/AKAP1 ↗
- Edges
- 3
- Neighbours
- 1 cancers2 variants
- Drawn
- 3 of 3 neighbours (cap 60); table lists every fetched edge
Accepted: cancer:<slug>, gene:<symbol>, variant:<slug>, drug:<slug>, trial:<NCT id>, or a bare CI id. Find slugs with search.
Most connectedLung Non-Small Cell Carcinoma 3,147Malignant Colorectal Neoplasm 1,866ABL1 298EGFR 276Imatinib 450Dasatinib 321
Neighbourhood
Radial view
Focus at the centre; neighbours grouped by entity type. Click a node to re-centre the graph on it; ↗ opens the entity page. Hover a spoke for relationship, evidence level, cancer context and source.
Edges
Every edge, grouped by relationship
Source-native edges first (aggregated per neighbour, direction, evidence level and source), then derived registry links. Up to 15 per relationship (10 trials); “show all” raises one group to 200.
| Relationship | Neighbour | Direction | Evidence level | Cancer context | Support | Claim | Source | Expand |
|---|---|---|---|---|---|---|---|---|
| AKAP1 has variant …HAS_VARIANTderived2 of 2 | ||||||||
| → has variant | NM_003488.4(AKAP1):c.239A>G (p.Lys80Arg)SNV no accepted CIViC evidence item (variant record only) | — | — | not mapped | 0 | Observed | civic | graph → |
| → has variant | NM_003488.4(AKAP1):c.946GGCTTGGATAGAAATGAGGAG[1] (p.316GLDRNEE[1])other no accepted CIViC evidence item (variant record only) | — | — | not mapped | 0 | Observed | ||